HELP! Josephine Maestra (age 89), born 21 September 1913, in Chama, Rio Arriba, New Mexico, has asked me to find the birth information of her mother, Felima Montoya. I am looking for the birth parents of the following: Felima Montoya Born: 17 October 1887 Place: unsure Believe: Velarde, Rio Arriba, New Mexico but could be anywhere in Rio Arriba Believe parents were: Father: Jose Gregorio or Gregorio Montoya Mother: Juanita????? Felima and her brother were adopted by Manuel de Esquipulas Miera and his wife (name unknown) according to the 1900 census. Can anyone help me by giving me the names and addresses of the Catholic churches in Rio Arriba in the late 1800's. How about the county clerks office and the county library (address & e-mail site). Jim Morgan [email protected] ________________________________________________________________ GET INTERNET ACCESS FROM JUNO! Juno offers FREE or PREMIUM Internet access for less! Join Juno today! For your FREE software, visit: http://dl.www.juno.com/get/web/.
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/0RB.2ACI/559.1 Message Board Post: Contact the paper through their site at ABQJOURNAL.COM. I'm sure they can help you. If not, please contact me and I'll see what I can do.
This is a Message Board Post that is gatewayed to this mailing list. Classification: Obituary Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/0RB.2ACI/561 Message Board Post: Albuquerque Journal - March 8 1998 Arlene M. Dyckes, 67, a resident of Albuquerque since 1956, died Thursday, March 5, 1998. She is survived by her sons, George Dyckes and wife, Susan of Fair Oaks, CA and Bruce Dyckes and wife, Karen of Albuquerque; grandchildren, Ian Dyckes and Madeleine Dyckes of Fair Oaks, CA; sisters, Evelyn Markow and husband, Steve, Esther Zygai, and Donna Gesiakowski all of Erie, PA; brother, Jim Gray and wife, Ruth of Erie, PA; and several nephews and nieces. Ms. Dyckes worked for Sandia National Laboratory for 20 years and retired in 1995 as a department secretary. She enjoyed fishing and raising her two sons. Ms. Dyckes was very devoted to her family and her job. She loved New Mexico tremendously and enjoyed the native arts and cuisine. Services will be held Monday, 3:30 p.m. at French Mortuary, Lomas Blvd. Chapel, 10500 Lomas NE, with Pastor Rick Donaho officiating. Friends may visit French Mortuary, 10500 Lomas Blvd. NE, Sunday from 3:00 until 8:00 p.m. Per Ms. Dyckes wishes, she ! will be cremated after services. French Mortuary, 10500 Lomas Blvd. NE.
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/0RB.2ACI/121.1 Message Board Post: Hello, my name is Penelope. I am the daughter of Arthur L. Sullivan, who lives in Roswell, New Mexico. My father was raised by his grandfather in Albuquerque. His grandfathers name was James Walter Sullivant, his grandmother was Epitacia. His fathers name was Paul. You can get in touch with me at my husbands email [email protected] or me at [email protected] Thanks
This is a Message Board Post that is gatewayed to this mailing list. Surnames: Brown Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/0RB.2ACI/254.1 Message Board Post: This is probably coincidence but Im trying to find Mary E. Brown who supposedly passed away in Albuquerque, 26 Apr 1965, aged 85 years, burial at Sunset Memorial Park. Mary had the following children. I know Emma moved to New Mexico and is not your Emma, however, with Frank listed and Emma I was wondering if we have a connection. 1. Chester William Brown, born 17 Apr 1898, died 23 Jan 1959, 2. Edna Mary Brown, born 9 Jan 1900, 3. Frank Aaron Brown, born 15 Aug 1901,4. Emma Elizabeth Brown, born 26 Oct 1903, 5. Grace Violet Brown, born 15 Nov 1905, 6. Irene Jennie Brown, born 1 Apr 1913,
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/0RB.2ACI/418.421.1 Message Board Post: Robert, I was wondering if I could buy a copy of the recording that you have of your grandmother talking about Jose Perea & Abe Lincoln. My mother's great grandfather was Col. Francisco Perea. Thanks.
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/0RB.2ACI/560 Message Board Post: LUCIO DURAN born 1876 in NM, and died 1971 in Albuquerque, NM. We have a Great-uncle with the same name, JOSE LUCIO DURAN between 1872-1875 in New Mexico. Would like to find out if this is same person. Please reply if you have information on the above named. Appreciate it. R.
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/0RB.2ACI/559 Message Board Post: William Oney HANSHAW died in Albuquerque 2 March 1958. Where and how can I obtain a copy of his obituary? Thanks.
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/0RB.2ACI/377.405.1 Message Board Post: Do you have an Isaac VanLeuven that married a Marinda Smith in the early 1800's?
This is a Message Board Post that is gatewayed to this mailing list. Surnames: Trujillo Wilson Wood Simmons Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/0RB.2ACI/80.1.1 Message Board Post: Hi, I am researching my great grandfather,Theodore Trujillo, from Albuquerque, NM, married to Cornelia Wilson. My grand mother Alta Grace Trujillo was from Trinidad, CO. She married Jerry Wood and settled in Fowler, CO. Trinidad is in Las Animas County, CO. There is an oral family history that my Trujillo family line was a part of a land grant around Albuquerque, NM. Below is a family history. Any infor would be appreciated. 1 Theodore Trujillo ---------------------------------------- Birth: Albuquerque, NM Spouse: Cornielia Wilson Children: Alta Grace (1908-1991) 1.1 Alta Grace Trujillo ---------------------------------------- Birth: 27 Apr 1908, Trinidad, Colorado Death: Nov 1991, Fowler, Colorado ss# 524-32-7800 Spouse: Jerry Wood Birth: 13 Feb 1892, Worth County, Grant City, MO Death: Jan 1971, Rocky Ford, Otero Co., Colorado Father: Edward Wood (1849-1924) Mother: Eliza Jane Simmons (1851-1940) Marr: 21 Dec 1927 Children: Edward Theodore (1934-) Jane (1929-1941) Jerry (1928-) Muriel (1932-) Corneilia (1936-) Mame (1937-) Franklin David (1941-) Janice Maude (1943-) William Daniel (1944-) Carol June (1946-) Mary Grace (1948-) Madaline Lee (1952-) 1.1.1 Edward Theodore Wood ---------------------------------------- Birth: 13 Feb 1934, Fowler, Colorado Spouse: Jeris Nanette Fleischacker Birth: 29 Jun 1936, Otero County, La Junta, Colorado Death: 17 Feb 1977, Otero County, La Junta, Colorado Father: Paul Ralph Fleischacker (1898-1985) Mother: Effie (Brooks) Belle Wright (1908-1985) Marr: 26 Aug 1955, Raton, NM Children: Paul Ivan (1960-) David Edward (1963-) Jeris Marie (1966-) 1.1.1.1 Paul Ivan Wood ---------------------------------------- Birth: 12 Jan 1960, Otero, County, La Junta, Colorado 5 lb, 8 3/4 oz 19" Long @ 7 weeks 9 lb, 8 oz 22" Long Oxford Ancestors mtDNA Sequence: ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGTCACCCCTCACCCATTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGGC Mutations at positions (129, 256, 270, 399) Oxford Ancestors Y-STR signature: DYS394/19 15 DYS388 12 DYS390 24 DYS391 11 DYS392 14 DYS393 13 DYS389i 10 DYS389ii 16 DYS425 12 DYS426 12 Relative Genetics/Ancestry.com paternal signature: DYS385a B (11) DYS385b G (16) DYS388 12 DYS389i 13 DYS389ii 29 DYS390 24 DYS391 11 DYS392 14 DYS393 13 DYS394 15 DYS426 12 DYS437 17 DYS438 12 DYS439 12 DYS460 10 DYS461 10 DYS462 11 GGAAT1B07 10 YCAIIa D (19) YCAIIb H (23) Y-GATA-A10 12 Y-GATA-A4 12 Y-GATA-C4 25 Y-GATA-H4 28 Relative Genetics/Ancestry.com Maternal signature: HVR2 73[G] 150[T] 263[G] HVR1 16129[A] 16256[T] 16270[T] 16399[G] Spouse: Teresa (Terri) Lynn Gelenian Birth: 10 Jun 1955, Racine County, Racine, Wisconsin Father: Ovagem (Augie) Gelenian (1928-1983) Mother: Rosemary Krikorian (1930-) Marr: 25 Jun 1988, Racine, Wisconsin 1.1.1.2 David Edward Wood ---------------------------------------- Birth: 20 Dec 1963, Otero County, La Junta CO 1.1.1.3 Jeris Marie Wood ---------------------------------------- Birth: 4 Apr 1966, Otero County, La Junta CO 4 lb, 4 1/4 oz 17" 1.1.2 Jane Wood ---------------------------------------- Birth: 29 Oct 1929 Death: 19 Feb 1941 1.1.3 Jr Jerry Wood ---------------------------------------- Birth: 10 Oct 1928 Spouse: Juanita Faye Clark 1.1.4 Muriel Wood ---------------------------------------- Birth: 16 Sep 1932 Spouse: Vincent Gilman Telfer 1.1.5 Corneilia Wood ---------------------------------------- Birth: 26 Apr 1936 Spouse: Eldon Reynolds 1.1.6 Mame Wood ---------------------------------------- Birth: 6 Sep 1937 Spouse: Gerald Phillips Children: Jane 1.1.6.1 Jane Phillips ---------------------------------------- 1.1.7 Franklin David Wood ---------------------------------------- Birth: 1 Jan 1941 Spouse: Judy Children: Kimberly Ann David Tracy 1.1.7.1 Kimberly Ann Wood ---------------------------------------- 1.1.7.2 David Wood ---------------------------------------- 1.1.7.3 Tracy Wood ---------------------------------------- 1.1.8 Janice Maude Wood ---------------------------------------- Birth: 19 Nov 1943 1.1.9 William Daniel Wood ---------------------------------------- Birth: 1 Aug 1944, Fowler, Colorado Spouse: Victoria Lee Goudy Birth: 27 Feb 1948, Fowler, Colorado Father: Vic Goudy Children: William Brandon (1970-) Joy Marie (1974-) 1.1.9.1 William Brandon Wood ---------------------------------------- Birth: 31 Oct 1970, Otero County, La Junta CO Spouse: Elizabeth Marie Wilke Birth: 7 Oct 1971 Children: Bryan Daniel (1995-) Jason Kyle (2001-) 1.1.9.1.1 Bryan Daniel Wood ---------------------------------------- Birth: 28 Oct 1995, Otero County, La Junta CO 1.1.9.1.2 Jason Kyle Wood ---------------------------------------- Birth: 15 Jan 2001, Otero County, La Junta CO 1.1.9.2 Joy Marie Wood ---------------------------------------- Birth: 21 Aug 1974, Otero County, La Junta CO Spouse: Stephen Donnell Grayson Birth: 23 Apr 1966 Children: Laiken Marie (1995-) Tristan Lee (1997-) 1.1.9.2.1 Laiken Marie Grayson ---------------------------------------- Birth: 13 Nov 1995 1.1.9.2.2 Tristan Lee Grayson ---------------------------------------- Birth: 10 Jun 1997 1.1.10 Carol June Wood ---------------------------------------- Birth: 27 Jun 1946 Spouse: James Clark Children: Ricky Jimmy 1.1.10.1 Ricky Clark ---------------------------------------- 1.1.10.2 Jimmy Clark ---------------------------------------- 1.1.11 Mary Grace Wood ---------------------------------------- Birth: 16 Apr 1948 1.1.12 Madaline Lee Wood ---------------------------------------- Birth: 3 Feb 1952 Index ? Judy spouse of 1.1.7 Clark James spouse of 1.1.10 Jimmy 1.1.10.2 Juanita Faye spouse of 1.1.3 Ricky 1.1.10.1 Fleischacker Jeris Nanette spouse of 1.1.1 Gelenian Teresa (Terri) Lynn spouse of 1.1.1.1 Goudy Victoria Lee spouse of 1.1.9 Grayson Laiken Marie 1.1.9.2.1 Stephen Donnell spouse of 1.1.9.2 Tristan Lee 1.1.9.2.2 Phillips Gerald spouse of 1.1.6 Jane 1.1.6.1 Reynolds Eldon spouse of 1.1.5 Telfer Vincent Gilman spouse of 1.1.4 Trujillo Alta Grace 1.1 Theodore 1 Wilke Elizabeth Marie spouse of 1.1.9.1 Wilson Cornielia spouse of 1 Wood Bryan Daniel 1.1.9.1.1 Carol June 1.1.10 Corneilia 1.1.5 David 1.1.7.2 David Edward 1.1.1.2 Edward Theodore 1.1.1 Franklin David 1.1.7 Jane 1.1.2 Janice Maude 1.1.8 Jason Kyle 1.1.9.1.2 Jeris Marie 1.1.1.3 Jerry spouse of 1.1 Jr Jerry 1.1.3 Joy Marie 1.1.9.2 Kimberly Ann 1.1.7.1 Madaline Lee 1.1.12 Mame 1.1.6 Mary Grace 1.1.11 Muriel 1.1.4 Paul Ivan 1.1.1.1 Tracy 1.1.7.3 William Brandon 1.1.9.1 William Daniel 1.1.9
Looking for information on the following: Rio Arriba, Santa Fe or Bernalillo marriage. Marriage of Gregorio or Jose Gregorio Montoya between the years of 1880 to 1887 to anyone, possibly a woman named Juanita. He was listed as being single, age 27, on the 1880 census. Jose Gregorio's parents were Jesus Montoya and Maria Estefana Sanchez. He was born 3 December 1853 in Santa Cruz de la Canada, wife may have been from Bernalillo. Any help would be greatly appreciated. From: Jim Morgan, trying to help a close friend, Yvonne Trujillo, find her great-grandparents. ________________________________________________________________ GET INTERNET ACCESS FROM JUNO! Juno offers FREE or PREMIUM Internet access for less! Join Juno today! For your FREE software, visit: http://dl.www.juno.com/get/web/.
This is a Message Board Post that is gatewayed to this mailing list. Classification: Census Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/0RB.2ACI/558 Message Board Post: Hello there New Mexican Researcher, My name is Sam-Quito Padilla G., and I am the Head Coordinator for the New Mexico Death Index Project. I am sending and SOS out for assistance to the newest project under the NMDI (New Mexico Death Index) Project. I am not sure if you are familiar with the project, check it out at: http://www.rootsweb.com/~usgenweb/nm/nmdi.htm . Although the NMDI Project is not completed, I wanted to give you an update on what is happening. The Section 3 (years 1941 to 1950) has been put back at least until January of 2003. The death index has not been filmed, still on paper. The department said that they are very shorthanded and will try to get to the death index by December or early 2003. There are many people waiting for this section to be completed and will make an announcement when this part of the project starts. Our volunteers are still very restless in doing something, so we have started to index the 1930 New Mexico Census. A soundex was not done for New Mexico and many other states for the 1930 Census. We have started this important project and looking for assistance from people as yourself. Please check out the NMDI website and see how you can help out in this important project as we need your help at: http://www.rootsweb.com/~usgenweb/nm/nmdi.htm and there is a link in the lower part of the page about the NMDI Projects. Bye for now, Sam-Quito [email protected]
This is a Message Board Post that is gatewayed to this mailing list. Surnames: FARRAR Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/0RB.2ACI/556 Message Board Post: He and his family emigrated from Batley, England and made many returns to visit relations. I am in England trying to trace his descendants. Grateful for any information to [email protected]
This is a Message Board Post that is gatewayed to this mailing list. Surnames: Ross, Bakey Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/0RB.2ACI/555 Message Board Post: I am seeking info. about Charles & Emma (Bakey) Ross. I have located them in census' living in Los Barelas in the 1900, 1910 and in Albuquerque 1920. Their known children: Anna, William, Sadie, Charles, Harold, Minnie, Ted (Theodore) were born in NM, 1885 - 1906. Several male familymembers worked for the railroad. Any info. is sincerely appreciated.
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/0RB.2ACI/554 Message Board Post: MIQUELITA ROMERO born 1899 in New Mexico, and died in 1966 in Alburquerque, NM. She was married to MANUEL SAAVEDRA who died in 1975 in Alburquerque, NM. MIQUELITA ROMERO's Mother (Pablita Saavedra) had a Sister named NESTORA SAAVEDRA. Nestora Saavedra married my Great-uncle named JOSE MANUEL DURAN in 1900 in the San Miguel County of New Mexico. For genealogy purposes, I am trying to obtain the following information: Did Nestora Saavedra & Jose Manuel Duran have any children? Their names? Who they married? When they died, and where they are buried? When did Nestora Saavedra die? Where was she buried? And her husband? If you have any information on the above names and families, please reply. Would appreciate any info you have to share. Thanks - Rachel
This is a Message Board Post that is gatewayed to this mailing list. Classification: Obituary Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/0RB.2ACI/553 Message Board Post: Albuquerque Journal - March 5, 1998 Mr. Edward (Eddie) Valtierra died in Albuquerque at the age of 40. Eddie was a lifelong resident of Albuquerque. He was a member of the Calvary Chapel. He was preceded in death by his father, Frank J. Valtierra; brother, David Valtierra; and step-father, Bill Potts. He worked for the Albuquerque Boys and Girls Club, and at Salazar and Sons Mortuary. He was a loving son, brother, uncle and friend, and he will be greatly missed. Eddie is survived by his mother, Aurora Potts; brothers, Frank Valtierra and wife, Ilene, George Valtierra, Tony Potts and wife, Leticia, and Charles Potts; sisters, Dolores Valtierra, Theresa Lopez and husband, Charles, and Diane Potts; and numerous nieces and nephews. Funeral services for Eddie will be held on Saturday at Calvary of Albuquerque, 4001 Osuna NE, where the service will begin at 9:00 a.m. Burial will take place at the Mt. Calvary Cemetery. Pallbearers will be Frank Valtierra, Charles Potts, Tony Potts, Charles Lopez, Joe Pelletier, and L! ouis Salazar. Visitation will be held on Friday, from 1:00 p.m. until 7:00 p.m., at Salazar and Sons Mortuary, 400 3rd St. SW.
This is a Message Board Post that is gatewayed to this mailing list. Surnames: WATTS Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/0RB.2ACI/552 Message Board Post: Searching for Harry Watts. Was in the Air Force in Homestead, FL. In 1969: First wife: Gina, son Jim, daughter Jennifer (deceased), dog Fang. Last I heard, his wife's name is Judy, has another son, Joey. Really would like to find my friends. Please contact Aunt Barbou
This is a Message Board Post that is gatewayed to this mailing list. Classification: Obituary Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/0RB.2ACI/551 Message Board Post: Albuquerque Journal, March 31, 1998 LeRoy G. (better known as Roy) Rainhart, 79, passed away Friday, February 27, 1998. He is survived by his wife, Roberta of 54 years; son, George Robert Rainhart and wife, Dolly of Albuquerque; daughter, Jean Rainhart of Prokopiak of Albuquerque; granddaughter, Lara Ann Rainhart and husband, Jason Digman of Evanston, IL; grandson, Robert Latta Rainhart and wife, Elizabeth of Kissimmee, FL; three cousins, Benjamin Foot and wife, Lois, and George Foot and wife, Nancy, and Charles Foot and wife, Jean, all of Albuquerque. Roy joined the Presbyterian Church at age 12; he later taught Sunday School and sponsored a Junior High Fellowship Group with his wife, Roberta. He was an ordained Elder and Deacon. Following graduation from NYU, with a BME, he was hired by Bell Telephone Laboratories. During World War II, he was CO of the 98st Engineers, which was part of General Patton's"spearhead across Europe." He retired from ATT Bell Laboratories in 1987 with 40 years, which included the f! our years in the Army and 28 years on a leave of absence to Sandia Labs to work on plastics and special materials. Cremation has taken place and memorial services will be held Friday, 7:00 p.m., at St. Andrews Presbyterian Church, 5301 Ponderosa NE, with Rev. officiating. Interment will follow at Santa Fe National Cemetery. Family requests that memorial contributions be made to the St. Andrews Presbyterian Capital Maintenance and Replacement Fund, 5301 Ponderosa NE, Albuquerque 87110. French Mortuary, 7121 Wyoming Blvd. 87109.
This is a Message Board Post that is gatewayed to this mailing list. Classification: Obituary Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/0RB.2ACI/550 Message Board Post: Albuquerque Journal, March 3, 1998 Catherine Morgan Apprill, 77, died peacefully in her home on February 28th. She is survived by her daughters, Ann L. Payne and husband, Don of Broken Arrow, OK, Mary Apprill-Gates and husband, Terry Gates of Rio Rancho, NM, and Jeanette Apprill of Albuquerque; son, Phil. M. Apprill and wife, Diane of Plano, TX; grandchildren, Christina Jardee and husband, Steven, Don P. Payne, Evelyn Payne, Aaron Payne, Bryn Catherine Apprill, Chris Gates and Brian Gates; great-grandchildren, Daniel, Jonathan, and Micah Jardee and other loving family. She was preceded in death by her husband, Gilbert Apprill; and her brother, Art Morgan Jr. Catherine was born in Santa Fe and was the daughter of Art Morgan, a well known journalist and editor for the New Mexican. She attended the University of New Mexico and was an active member of the Chi Omega sorority. Upon a graduation in 1943, she moved to Washington, DC and took a position at the Pentagon, where she worked in the clerical pool. During a ! visit to Santa Fe in 1946. Catherine met Gil Apprill and her life took an unexpected turn. On September 19, 1947 they were wed at St. Frances Cathedral, after which they took up residence in Los Alamos, where they lived for the next 30 years. Catherine was a devoted homemaker and mother, constantly involved in the lives of her four children. She was active in the Immaculate Heart of Mary Catholic Church, participated in many social groups and was well known for her award winning knitting. She taught knitting in nigh school classes and was a teacher's aide at Los Alamos High for many years. Catherine and Gil moved to Albuquerque in 1977, which led to 20 years of traveling, enjoying her grandchildren and socializing with her many dear friends. Though diagnosed with cancer in 1993, she managed to sustain a vibrant lifestyle and a positive outlook through some difficult times. Catherine was a loving and supportive mother and wife. She was a loyal and caring friend. Catherine's l! egacy to her family and friends is an enduring gift of love, faith and kindness that will forever brighten our lives and lift our spirits. Rosary will be recited Friday, 6:00 p.m., at French Mortuary, Wyoming Blvd. Chapel, 7121 Wyoming Blvd. NE, with Deacon Lloyd Martinez reciting. Mass will be celebrated Saturday, 11:00 a.m., at Sangre De Cristo Catholic Church, 8901 Candelaria NE, with Fr. Albert Podvin, Celebrant. Interment will follow at Gate of Heaven Cemetery. Family requests memorial contributions be made to Presbyterian Hospice, 8300 Constitution Ave. NE 87110. French Mortuary, 7121 Wyoming Blvd. NE.
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/0RB.2ACI/549 Message Board Post: HI: I am searching for Argus Shope (1894-Nov 1970) & his wife Anna (1902-11 Jul 1989). He died in Albuquerque according to the SSDI, she died in SantaCruzCnty, but surely is buried with her husband. Would like to know the name of the cem (if in a book the name & page of the book too). Any help would be appreciated. Do you know about their children? Dianna