Hi Judy, good question. I've posted it to the forum so others might benefit as well. I personnaly haven't had my DNA run yet but from my research, most of the Costellos and Corbetts I've seen from Ireland are in the Rb1 or R1b1 haplogroup. For example, see the Corbett Project at Family Tree http://www.worldfamilies.net/surnames/c/corbett/results.html The various numbers you refer to (DYS 314, etc.) are genetic marker names. Specifically, they are different microsatellite loci on the Y chromosome (the one that determines whether you are male or female). Microsatellites are bits of DNA that have the same short sequence repeated a number of times in a row. The number you get with your results is the number of repeats. Let's make up a marker... well call it DSY001 Allan CATCATCATCATCATCATCATCAT Judy CATCATCATCATCATCATCATCATCATCATCATCAT RESULTS Allan DSY001 8 Judy DSY001 12 ... here the CAT motif is repeated 8 times in a row for me and 12 times for you, so we get different results at the marker. The key with these microsatellites is that some are very variable among families (others only variable among major groups) so that when you run enough markers (37 seems to be the standard number now for high-resolution results) you are able to pinpoint your genetic affinities, BUT only if related families have submitted their DNA for comparison. Microsatellites don't code for anything and are not associated with things such as hair or eye color... think of them as filler between the genes that do code for your traits. Hope it helps... ABC At 06:17 AM 13/11/2006, you wrote: >Dear Allan, > >Do you happen to know what Haplogroup you are in? Genebase tentatively put >me in Q but FamilyTree says most of my matches are R1. So after the >holidays I will send another kit to my brother from FamilyTree. >Incidently, I have been doing this genealogy since 1996 but just now got >interested in the DNA stuff. Do you know what the various numbers mean? >DYS.... hair color, height etc? >Judy > >Judy Corbett Barker >St. Petersburg, Florida and Holyrood, Newfoundland, Canada >Researching the Channel Islands, Ireland, Newfoundland and New Jersey. >Visit my website at http://members.aol.com/judyb3753/index.html ---------------------------------------------------------------------------- Allan B. Costello (a.k.a. "East Coast Al") Native Fish Research Group Ph.D. Candidate Department of Zoology University of British Columbia 6270 University Blvd. Vancouver, B.C. Canada V6T 1Z4 Work: 1 (604) 822-1301 Email: [email protected] ----------------------------------------------------------------------------