Hi Judy here are a few of the web sites I use for DNA info, some of them are family sites but still have explanations of the DNA origins and identification process. http://www.kerchner.com/dna-information.htm http://www.mun.ca/biology/scarr/Daughters_of_Eve_in_Newfoundland.html https://www3.nationalgeographic.com/genographic/index.html http://blairgenealogy.com/dna/dna101.html http://groups.yahoo.com/group/ISOGG/ http://www.dnaftb.org/dnaftb/ http://www.answers.com/topic/the-seven-daughters-of-eve http://www.duerinck.com/genetic.html There are obviously many many more. I did see a website that showed the haplogroup spread by percentage in Europe but cannot seem to locate it now. Best wishes. Ed Barbour ----- Original Message ----- From: "Allan B. Costello" <[email protected]> To: <[email protected]> Cc: <[email protected]>; <[email protected]> Sent: Monday, November 13, 2006 1:17 PM Subject: Re: [NFLD-LAB] DNA > Hi Judy, good question. I've posted it to the forum so others might > benefit > as well. I personnaly haven't had my DNA run yet but from my research, > most of the Costellos and Corbetts I've seen from Ireland are in the Rb1 > or > R1b1 haplogroup. For example, see the Corbett Project at Family Tree > > http://www.worldfamilies.net/surnames/c/corbett/results.html > > The various numbers you refer to (DYS 314, etc.) are genetic marker names. > Specifically, they are different microsatellite loci on the Y chromosome > (the one that determines whether you are male or female). Microsatellites > are bits of DNA that have the same short sequence repeated a number of > times in a row. The number you get with your results is the number of > repeats. > > Let's make up a marker... well call it DSY001 > > Allan CATCATCATCATCATCATCATCAT > Judy CATCATCATCATCATCATCATCATCATCATCATCAT > > > RESULTS > > Allan DSY001 8 > Judy DSY001 12 > > > ... here the CAT motif is repeated 8 times in a row for me and 12 times > for > you, so we get different results at the marker. > > The key with these microsatellites is that some are very variable among > families (others only variable among major groups) so that when you run > enough markers (37 seems to be the standard number now for high-resolution > results) you are able to pinpoint your genetic affinities, BUT only if > related families have submitted their DNA for comparison. Microsatellites > don't code for anything and are not associated with things such as hair or > eye color... think of them as filler between the genes that do code for > your traits. > > Hope it helps... > > ABC > > > > > > At 06:17 AM 13/11/2006, you wrote: >>Dear Allan, >> >>Do you happen to know what Haplogroup you are in? Genebase tentatively put >>me in Q but FamilyTree says most of my matches are R1. So after the >>holidays I will send another kit to my brother from FamilyTree. >>Incidently, I have been doing this genealogy since 1996 but just now got >>interested in the DNA stuff. Do you know what the various numbers mean? >>DYS.... hair color, height etc? >>Judy >> >>Judy Corbett Barker >>St. Petersburg, Florida and Holyrood, Newfoundland, Canada >>Researching the Channel Islands, Ireland, Newfoundland and New Jersey. >>Visit my website at http://members.aol.com/judyb3753/index.html > > ---------------------------------------------------------------------------- > Allan B. Costello (a.k.a. "East Coast Al") > Native Fish Research Group > Ph.D. Candidate > Department of Zoology > University of British Columbia > 6270 University Blvd. > Vancouver, B.C. > Canada V6T 1Z4 > Work: 1 (604) 822-1301 > Email: [email protected] > ---------------------------------------------------------------------------- > > > ------------------------------- > To unsubscribe from the list, please send an email to > [email protected] with the word 'unsubscribe' without the > quotes in the subject and the body of the message