Note: The Rootsweb Mailing Lists will be shut down on April 6, 2023. (More info)
RootsWeb.com Mailing Lists
Previous Page      Next Page
Total: 3340/10000
    1. Re: [NFLD-LAB] Correction 1921 census
    2. Roadrunner
    3. Hi Wilson I am sure that if you will send a note to the people at the Grand Banks Site, they will be glad to check that out for you. They are the ones who have a full set of the census pages and can send you a copy of those families if you would like. Don Wilson and Yvonne Dicks wrote: > Hi > I'm from the Burin area and looking at the surnames > below from the Burin area for the 1921 census there appears > to be an error. > I'm fairly certain that the "Gipph" surname is in errror > and that the "Grampton" surname should be "Frampton". > If you were to e-mail a copy of the actual written document > I'm quite certain I could transcribe it correctly. > > regards > Wilson > Gipph > Fredrick > M > Head > Married > 1896 > Sept > 25 > Burin > > > > Gipph > Mira ? > F > Wife > Married > 1895 > Oct > 25 > Hants Hbr. > > > > Gipph > Thomas > M > Son > Single > 1920 > June > 1 > Burin > > > > Gipph > Glora > F > Mother > Widow > 1864 > April > 57 > Flat Islands > > > > > > > Grampton > William > M > Head > Married > 1897 > Oct > 23 > Burin > > > > Grampton > Maud > F > Wife > Married > 1897 > Oct > 23 > Burin > > > > > > > ------------------------------- > To unsubscribe from the list, please send an email to [email protected] with the word 'unsubscribe' without the quotes in the subject and the body of the message >

    11/13/2006 12:40:35
    1. [NFLD-LAB] Pope Family Fogo Island
    2. Gerald & Margaret Major
    3. Wondering if anyone can connect the following POPE famalies to the Fogo Island Pope's ! Thanks Margaret 1935 Burnt Arm, NFLD POPE Abram Head M M 70 b 1865 POPE Jessie Wife F M 68 POPE James Head M M 23 b 1921 POPE Mary Wife F M 22 POPE Agnes Foster Child F S 10 POPE Helen Head F W 48 POPE Bertha Daughter F S 14 POPE Robert Son M S 12 POPE William Son M -- 8 POPE Katheleen Daughter F -- 4 POPE Philip Head M M 34 b 1901 POPE Elizabeth Wife F M 28 POPE Ferdinand Son M S 10 POPE Wesley Son M S 6 POPE Leonard Son M S 2 POPE Blanche Daughter F S 1

    11/13/2006 11:35:32
    1. Re: [NFLD-LAB] DNA
    2. Ed Barbour
    3. Hi Judy here are a few of the web sites I use for DNA info, some of them are family sites but still have explanations of the DNA origins and identification process. http://www.kerchner.com/dna-information.htm http://www.mun.ca/biology/scarr/Daughters_of_Eve_in_Newfoundland.html https://www3.nationalgeographic.com/genographic/index.html http://blairgenealogy.com/dna/dna101.html http://groups.yahoo.com/group/ISOGG/ http://www.dnaftb.org/dnaftb/ http://www.answers.com/topic/the-seven-daughters-of-eve http://www.duerinck.com/genetic.html There are obviously many many more. I did see a website that showed the haplogroup spread by percentage in Europe but cannot seem to locate it now. Best wishes. Ed Barbour ----- Original Message ----- From: "Allan B. Costello" <[email protected]> To: <[email protected]> Cc: <[email protected]>; <[email protected]> Sent: Monday, November 13, 2006 1:17 PM Subject: Re: [NFLD-LAB] DNA > Hi Judy, good question. I've posted it to the forum so others might > benefit > as well. I personnaly haven't had my DNA run yet but from my research, > most of the Costellos and Corbetts I've seen from Ireland are in the Rb1 > or > R1b1 haplogroup. For example, see the Corbett Project at Family Tree > > http://www.worldfamilies.net/surnames/c/corbett/results.html > > The various numbers you refer to (DYS 314, etc.) are genetic marker names. > Specifically, they are different microsatellite loci on the Y chromosome > (the one that determines whether you are male or female). Microsatellites > are bits of DNA that have the same short sequence repeated a number of > times in a row. The number you get with your results is the number of > repeats. > > Let's make up a marker... well call it DSY001 > > Allan CATCATCATCATCATCATCATCAT > Judy CATCATCATCATCATCATCATCATCATCATCATCAT > > > RESULTS > > Allan DSY001 8 > Judy DSY001 12 > > > ... here the CAT motif is repeated 8 times in a row for me and 12 times > for > you, so we get different results at the marker. > > The key with these microsatellites is that some are very variable among > families (others only variable among major groups) so that when you run > enough markers (37 seems to be the standard number now for high-resolution > results) you are able to pinpoint your genetic affinities, BUT only if > related families have submitted their DNA for comparison. Microsatellites > don't code for anything and are not associated with things such as hair or > eye color... think of them as filler between the genes that do code for > your traits. > > Hope it helps... > > ABC > > > > > > At 06:17 AM 13/11/2006, you wrote: >>Dear Allan, >> >>Do you happen to know what Haplogroup you are in? Genebase tentatively put >>me in Q but FamilyTree says most of my matches are R1. So after the >>holidays I will send another kit to my brother from FamilyTree. >>Incidently, I have been doing this genealogy since 1996 but just now got >>interested in the DNA stuff. Do you know what the various numbers mean? >>DYS.... hair color, height etc? >>Judy >> >>Judy Corbett Barker >>St. Petersburg, Florida and Holyrood, Newfoundland, Canada >>Researching the Channel Islands, Ireland, Newfoundland and New Jersey. >>Visit my website at http://members.aol.com/judyb3753/index.html > > ---------------------------------------------------------------------------- > Allan B. Costello (a.k.a. "East Coast Al") > Native Fish Research Group > Ph.D. Candidate > Department of Zoology > University of British Columbia > 6270 University Blvd. > Vancouver, B.C. > Canada V6T 1Z4 > Work: 1 (604) 822-1301 > Email: [email protected] > ---------------------------------------------------------------------------- > > > ------------------------------- > To unsubscribe from the list, please send an email to > [email protected] with the word 'unsubscribe' without the > quotes in the subject and the body of the message

    11/13/2006 08:13:04
    1. Re: [NFLD-LAB] DNA
    2. Dear Ed, I think I will have to find more extensive DNA studies. I know the Newfoundland DNA is unique. I like that site re: Eve. Don't know how they came upon all that information and names. Judy Judy Corbett Barker St. Petersburg, Florida and Holyrood, Newfoundland, Canada Researching the Channel Islands, Ireland, Newfoundland and New Jersey. Visit my website at http://members.aol.com/judyb3753/index.html

    11/13/2006 07:04:21
    1. Re: [NFLD-LAB] DNA
    2. Allan B. Costello
    3. Hi Judy, good question. I've posted it to the forum so others might benefit as well. I personnaly haven't had my DNA run yet but from my research, most of the Costellos and Corbetts I've seen from Ireland are in the Rb1 or R1b1 haplogroup. For example, see the Corbett Project at Family Tree http://www.worldfamilies.net/surnames/c/corbett/results.html The various numbers you refer to (DYS 314, etc.) are genetic marker names. Specifically, they are different microsatellite loci on the Y chromosome (the one that determines whether you are male or female). Microsatellites are bits of DNA that have the same short sequence repeated a number of times in a row. The number you get with your results is the number of repeats. Let's make up a marker... well call it DSY001 Allan CATCATCATCATCATCATCATCAT Judy CATCATCATCATCATCATCATCATCATCATCATCAT RESULTS Allan DSY001 8 Judy DSY001 12 ... here the CAT motif is repeated 8 times in a row for me and 12 times for you, so we get different results at the marker. The key with these microsatellites is that some are very variable among families (others only variable among major groups) so that when you run enough markers (37 seems to be the standard number now for high-resolution results) you are able to pinpoint your genetic affinities, BUT only if related families have submitted their DNA for comparison. Microsatellites don't code for anything and are not associated with things such as hair or eye color... think of them as filler between the genes that do code for your traits. Hope it helps... ABC At 06:17 AM 13/11/2006, you wrote: >Dear Allan, > >Do you happen to know what Haplogroup you are in? Genebase tentatively put >me in Q but FamilyTree says most of my matches are R1. So after the >holidays I will send another kit to my brother from FamilyTree. >Incidently, I have been doing this genealogy since 1996 but just now got >interested in the DNA stuff. Do you know what the various numbers mean? >DYS.... hair color, height etc? >Judy > >Judy Corbett Barker >St. Petersburg, Florida and Holyrood, Newfoundland, Canada >Researching the Channel Islands, Ireland, Newfoundland and New Jersey. >Visit my website at http://members.aol.com/judyb3753/index.html ---------------------------------------------------------------------------- Allan B. Costello (a.k.a. "East Coast Al") Native Fish Research Group Ph.D. Candidate Department of Zoology University of British Columbia 6270 University Blvd. Vancouver, B.C. Canada V6T 1Z4 Work: 1 (604) 822-1301 Email: [email protected] ----------------------------------------------------------------------------

    11/13/2006 01:47:18
    1. Re: [NFLD-LAB] GORMAN/ EZEKIEL from Conception Bay
    2. Dan Breen
    3. Thanks Allan. Cheers, Dan. ----- Original Message ----- From: "Allan B. Costello" <[email protected]> To: <[email protected]> Sent: Sunday, November 12, 2006 10:04 PM Subject: Re: [NFLD-LAB] GORMAN/ EZEKIEL from Conception Bay > Hey Dan... I'll have a boo and see what I have. I'm actually waiting on > some Gorman info from a contact I made... if I find something on Maria, > I'll pass it along. > > All the best... > > ABC > > At 03:16 PM 12/11/2006, you wrote: >>Hi Allan >>I have a Maria Gorman in my tree and have not be able to find her birth or >>parents or much else. Here is what I have on her and her husband. I would >>appreciate it if you see anything on her to let me know. Cheers, Dan. >> >> >>John Breen was born 14 Aug 1805 in St. John's, NF. Sponsors were Laurence >>Kitty/Bridget Fitzgerald. >> >>7 Feb 1829 >> John Breen and Maria Gorman were baptised in St. John's, >> Newfoundland, >>in the Roman Catholic Basilica of St. John the Baptist by Bishop M.A. >>Fleming. Sponsors were James Kennedy and Catherine Breen. They were both >>adults. >> I was not able to find the marriage record for John Breen and Maria >>Gorman. They had children up to 1852. Maria was listed as a widow as early >>as 1864. So he would have died between 1852 and 1864. >> I was not able to find the birth record for Maria Gorman. However, >> Paul >>Doherty found a death record that we believe to be our Maria. >> >>It stated: >> >> "Maria Breen, died 29th May 1908. Age 97. Place of residence was >> Signal >>Hill Road. Funeral from St. Mary's Church to Forest Road Cemetery. Service >>performed by Rev. Mosdell". >> >> A check with the cemetery records revealed that there was no >> headstone. >>Maria was 97 at the time of her death so she would have been born in 1811. >>She was living on George Street up until 1897-98 with her son and >>grandson. >>The 1904 Directory for St. John's showed two families of FARRELLs living >>on >>Signal Hill Road. These families could have been descendents of >>GGGGrandmother Mary Breen whose maiden name was FARRELL. Maria may have >>gone >>to live with them when she got older and couldn't care for herself. >> Uncle Frank said that a Bert Gorman lived near him on Stephen Street. >>Bert Gorman told him that they were cousins. Frank objected because Bert >>was >>a Protestant. Bert had a son Bert and a daughter Ella. Ella married a John >>Ryan. >> Frank tells a story about a Gorman woman who was a housekeeper at the >>Government House while Governor LaMarchand lived there. The Governor >>imported a side-saddle and invited his housekeeper to try it. She fell >>from >>the horse without much injury. Great Uncle Peter told Frank that she was >>our >>Great Grandmother. >> Frank says that there was a Gorman Lane behind the Basilica. >> >> >>-------------------------------------------------------------------------------- >> >> >> I also found marriages recorded in the Basilica that might be related >> to >>Maria Gorman. They stated: >> >>MICHAEL GORMAN married Grace LeCour. Sponsored by Michael McNamara and >>SIMON >>GORMAN. The date was 18th May 1799. >> >>SAMUEL BRIEN married MARY GORMAN. Sponsored by Michael McNamara and Mary & >>JOHN BRIEN. The date was 30th Jul 1799. >> >> >>------------------------------- >>To unsubscribe from the list, please send an email to >>[email protected] with the word 'unsubscribe' without the >>quotes in the subject and the body of the message > > > ------------------------------- > To unsubscribe from the list, please send an email to > [email protected] with the word 'unsubscribe' without the > quotes in the subject and the body of the message > > > -- > No virus found in this incoming message. > Checked by AVG Free Edition. > Version: 7.1.409 / Virus Database: 268.14.3/530 - Release Date: 11/11/2006 > >

    11/13/2006 01:14:38
    1. [NFLD-LAB] John Dalton
    2. Everett J Dalton
    3. I am trying to find information on a John DALTON who is named in the Kings Cove RC Registers c 1837. If someone could look this up and provide me with the info it would be greatly appreciated. Take care Everett

    11/12/2006 10:13:31
    1. Re: [NFLD-LAB] GORMAN/ EZEKIEL from Conception Bay
    2. Allan B. Costello
    3. Hey Dan... I'll have a boo and see what I have. I'm actually waiting on some Gorman info from a contact I made... if I find something on Maria, I'll pass it along. All the best... ABC At 03:16 PM 12/11/2006, you wrote: >Hi Allan >I have a Maria Gorman in my tree and have not be able to find her birth or >parents or much else. Here is what I have on her and her husband. I would >appreciate it if you see anything on her to let me know. Cheers, Dan. > > >John Breen was born 14 Aug 1805 in St. John's, NF. Sponsors were Laurence >Kitty/Bridget Fitzgerald. > >7 Feb 1829 > John Breen and Maria Gorman were baptised in St. John's, Newfoundland, >in the Roman Catholic Basilica of St. John the Baptist by Bishop M.A. >Fleming. Sponsors were James Kennedy and Catherine Breen. They were both >adults. > I was not able to find the marriage record for John Breen and Maria >Gorman. They had children up to 1852. Maria was listed as a widow as early >as 1864. So he would have died between 1852 and 1864. > I was not able to find the birth record for Maria Gorman. However, Paul >Doherty found a death record that we believe to be our Maria. > >It stated: > > "Maria Breen, died 29th May 1908. Age 97. Place of residence was Signal >Hill Road. Funeral from St. Mary's Church to Forest Road Cemetery. Service >performed by Rev. Mosdell". > > A check with the cemetery records revealed that there was no headstone. >Maria was 97 at the time of her death so she would have been born in 1811. >She was living on George Street up until 1897-98 with her son and grandson. >The 1904 Directory for St. John's showed two families of FARRELLs living on >Signal Hill Road. These families could have been descendents of >GGGGrandmother Mary Breen whose maiden name was FARRELL. Maria may have gone >to live with them when she got older and couldn't care for herself. > Uncle Frank said that a Bert Gorman lived near him on Stephen Street. >Bert Gorman told him that they were cousins. Frank objected because Bert was >a Protestant. Bert had a son Bert and a daughter Ella. Ella married a John >Ryan. > Frank tells a story about a Gorman woman who was a housekeeper at the >Government House while Governor LaMarchand lived there. The Governor >imported a side-saddle and invited his housekeeper to try it. She fell from >the horse without much injury. Great Uncle Peter told Frank that she was our >Great Grandmother. > Frank says that there was a Gorman Lane behind the Basilica. > > >-------------------------------------------------------------------------------- > > > I also found marriages recorded in the Basilica that might be related to >Maria Gorman. They stated: > >MICHAEL GORMAN married Grace LeCour. Sponsored by Michael McNamara and SIMON >GORMAN. The date was 18th May 1799. > >SAMUEL BRIEN married MARY GORMAN. Sponsored by Michael McNamara and Mary & >JOHN BRIEN. The date was 30th Jul 1799. > > >------------------------------- >To unsubscribe from the list, please send an email to >[email protected] with the word 'unsubscribe' without the >quotes in the subject and the body of the message

    11/12/2006 02:04:09
    1. [NFLD-LAB] surname McCabe
    2. Barbara
    3. Matt, My grandfathers name was James McCabe from Clarkes Beach, Newfoundland, he married Jane Edmunds from Roaches Line. His fathers name was Patrick McCabe, I believe his wife's name was Bridget Power from Cupids. I do know that Patrick died when James was about 2 or 3 years old. James was born Nov.5, 1900 and that he had no sibilings. I can't find any information on Patrick McCabe. Barb [email protected]

    11/12/2006 09:54:39
    1. Re: [NFLD-LAB] GORMAN/ EZEKIEL from Conception Bay
    2. Dan Breen
    3. Hi Allan I have a Maria Gorman in my tree and have not be able to find her birth or parents or much else. Here is what I have on her and her husband. I would appreciate it if you see anything on her to let me know. Cheers, Dan. John Breen was born 14 Aug 1805 in St. John's, NF. Sponsors were Laurence Kitty/Bridget Fitzgerald. 7 Feb 1829 John Breen and Maria Gorman were baptised in St. John's, Newfoundland, in the Roman Catholic Basilica of St. John the Baptist by Bishop M.A. Fleming. Sponsors were James Kennedy and Catherine Breen. They were both adults. I was not able to find the marriage record for John Breen and Maria Gorman. They had children up to 1852. Maria was listed as a widow as early as 1864. So he would have died between 1852 and 1864. I was not able to find the birth record for Maria Gorman. However, Paul Doherty found a death record that we believe to be our Maria. It stated: "Maria Breen, died 29th May 1908. Age 97. Place of residence was Signal Hill Road. Funeral from St. Mary's Church to Forest Road Cemetery. Service performed by Rev. Mosdell". A check with the cemetery records revealed that there was no headstone. Maria was 97 at the time of her death so she would have been born in 1811. She was living on George Street up until 1897-98 with her son and grandson. The 1904 Directory for St. John's showed two families of FARRELLs living on Signal Hill Road. These families could have been descendents of GGGGrandmother Mary Breen whose maiden name was FARRELL. Maria may have gone to live with them when she got older and couldn't care for herself. Uncle Frank said that a Bert Gorman lived near him on Stephen Street. Bert Gorman told him that they were cousins. Frank objected because Bert was a Protestant. Bert had a son Bert and a daughter Ella. Ella married a John Ryan. Frank tells a story about a Gorman woman who was a housekeeper at the Government House while Governor LaMarchand lived there. The Governor imported a side-saddle and invited his housekeeper to try it. She fell from the horse without much injury. Great Uncle Peter told Frank that she was our Great Grandmother. Frank says that there was a Gorman Lane behind the Basilica. -------------------------------------------------------------------------------- I also found marriages recorded in the Basilica that might be related to Maria Gorman. They stated: MICHAEL GORMAN married Grace LeCour. Sponsored by Michael McNamara and SIMON GORMAN. The date was 18th May 1799. SAMUEL BRIEN married MARY GORMAN. Sponsored by Michael McNamara and Mary & JOHN BRIEN. The date was 30th Jul 1799.

    11/12/2006 09:16:49
    1. Re: [NFLD-LAB] DNA primer
    2. Dera Allan, I did what you said re: YSearch and found several folks with same 9 markers as myself. I have sent emails to them. All of the were in the R1b1 group. Judy Judy Corbett Barker St. Petersburg, Florida and Holyrood, Newfoundland, Canada Researching the Channel Islands, Ireland, Newfoundland and New Jersey. Visit my website at http://members.aol.com/judyb3753/index.html

    11/12/2006 05:41:14
    1. Re: [NFLD-LAB] DNA primer
    2. Allan B. Costello
    3. Great Judy... hope it helps with your research. ABC At 09:41 AM 12/11/2006, you wrote: >Dera Allan, > >I did what you said re: YSearch and found several folks with same 9 markers >as myself. I have sent emails to them. All of the were in the R1b1 group. >Judy > >Judy Corbett Barker >St. Petersburg, Florida and Holyrood, Newfoundland, Canada >Researching the Channel Islands, Ireland, Newfoundland and New Jersey. >Visit my website at http://members.aol.com/judyb3753/index.html > >------------------------------- >To unsubscribe from the list, please send an email to >[email protected] with the word 'unsubscribe' without the >quotes in the subject and the body of the message

    11/12/2006 03:05:29
    1. Re: [NFLD-LAB] DNA primer
    2. Ed Barbour
    3. Hi, I had my DNA test done by the National Geographic Genome project. The output from this is a report that shows the historic path of your DNA. The purpose of the project is to map the DNA across the world. The project is collecting samples from all the indigenous peoples and samples from the world population. Once the test is done you have an option to have your DNA results uploaded to Family Tree DNA (no charge for this). At this site they match it to all the other DNA in their database, they also have family groups that you can subscribe to. They send you an email everytime they have a new DNA input that matches yours I found it to be a good site. Ed Barbour ----- Original Message ----- From: "Allan B. Costello" <[email protected]> To: <[email protected]> Sent: Saturday, November 11, 2006 11:56 PM Subject: Re: [NFLD-LAB] DNA primer > Hi Judy and anyone else who's interested... I had a poke around the Family > Tree DNA site http://www.familytreedna.com/ that someone had posted > earlier. They allow free searches of their database. If you go to : > > http://www.ysearch.org/search_search.asp?uid=&freeentry=true > > you can enter your own genetic data and search for a match in the ySearch > database. There are a series of markers... just enter into the pulldown > menus the ones for which you have info. There are some options you can > choose... limit to Europe or North America or whatever... then search. > Only > thing is I'm not sure if the genetic scoring between companies is > standardized. Maybe try it and see if the results make sense. If the > markers or allele scoring are different, you may get some strange results > and have to retest your DNA as they suggest. > > They also have a searchable list of SURNAMES. There are some Corbetts in > there if you have a look (Alphabetical List...) at top of page. > > Let me know how you make out... all the best! > > ABC > > > ------------------------------- > To unsubscribe from the list, please send an email to > [email protected] with the word 'unsubscribe' without the > quotes in the subject and the body of the message >

    11/11/2006 05:19:30
    1. Re: [NFLD-LAB] DNA primer
    2. Dear Ed, Thanks for the DNA and National Geographic information. However, I used genebase.com which is advertized everywhere. Family Tree says I must have their testing to be able to use their information. I will do that but not until after the holidays. Judy Judy Corbett Barker St. Petersburg, Florida and Holyrood, Newfoundland, Canada Researching the Channel Islands, Ireland, Newfoundland and New Jersey. Visit my website at http://members.aol.com/judyb3753/index.html

    11/11/2006 05:12:57
    1. Re: [NFLD-LAB] DNA primer
    2. Allan B. Costello
    3. Hi Judy and anyone else who's interested... I had a poke around the Family Tree DNA site http://www.familytreedna.com/ that someone had posted earlier. They allow free searches of their database. If you go to : http://www.ysearch.org/search_search.asp?uid=&freeentry=true you can enter your own genetic data and search for a match in the ySearch database. There are a series of markers... just enter into the pulldown menus the ones for which you have info. There are some options you can choose... limit to Europe or North America or whatever... then search. Only thing is I'm not sure if the genetic scoring between companies is standardized. Maybe try it and see if the results make sense. If the markers or allele scoring are different, you may get some strange results and have to retest your DNA as they suggest. They also have a searchable list of SURNAMES. There are some Corbetts in there if you have a look (Alphabetical List...) at top of page. Let me know how you make out... all the best! ABC

    11/11/2006 12:26:25
    1. Re: [NFLD-LAB] (no subject)
    2. Peg
    3. Hi, Because I had an address for my grandparents, I was able to find out that they were paying taxes, first in my grandfather's name and after his death, my grandmother was paying it. This was from City Hall. They had a lot of old records. Also, at the library of the Univ. there is a wealth of info on Newfoundland. I also found my grandfather's death notice even though it was a small notice on micro film. I live in Edgartown on Martha's Vineyard. Hope this helps some. Peg Nugent ----- Original Message ----- From: "art dalton" <[email protected]> To: <[email protected]> Cc: "Free/Marcia" <[email protected]> Sent: Friday, November 03, 2006 9:41 AM Subject: [NFLD-LAB] (no subject) > > HELLO listers, > > > > We have a problem that I hope one of you may be able to help us with: Are > there any centralized death records for St Johns ( late 1800's to early > 1900's) > > that might be kept in a City Hall or other such place? Also are there any > Central Cemetery records that would show date of death and possibly family > names? Please see below. > > > > For years all we knew about our paternal ancestors was that our > g-grandfather/grandmother were William Dalton(Dolton) and Deborah > Raine(Rhines). Both born in St. Johns, NL, William was born Jan 6,1848 and > Deborah was born abt. Sept 15,1840, they married May 31,1871 in St. > Johns. > > > > A year ago my brother went down to Lynn, MA, where they both died and > reviewed the available records to check the death notice for our > Great-Grandparents. William died Feb 29, 1904 at 55 years old. His parents > were listed as William Dalton and Susanna Biddiscombe, Susanna being born > in St Johns, NL and William being born in England. Deborah (maiden name > was > spelled Rhines) died March 20, 1936 at 95 years old. She was born in St > Johns. Her father's name was listed as John, born in England. No name was > given for her mother, but stated she was born in Newfoundland. > > > > After searching on the Newfounldand site, Chebucto, we found that Susanna > was born Sept 15, 1829 to George Biddiscombe and Elizabeth Harris. They > also > had a son James, born Feb 1827. Elizabeth died sometime in 1829 to 1831, > and > George married Anne Dowden on Jan 7, 1832. They had at least 2 children, > George Irwin, born Aug 3, 1834, and Margaret, born May 1. 1836. > > > > We also found that William Dalton (Dolton) and Susanna Biddiscombe were > married June 18,1847 at St Thomas Anglican Church in St Johns. Witnesses > were Catherine Biddiscombe and William Hiser. My brother sent an e-mail to > St. Thomas Church, looking for additional information from the marriage > record and they answered saying there was nothing further in the records. > > > > William and Susanna had the following children. Maybe someone out there > has > a connection to one of them. > > > > William, born Jan 6, 1848 ( Our Great-Grandfather as mentioned in the > beginning, married Deborah Rhines.) > > Catherine Theresa, born Aug 8, 1850 > > Elizabeth, born Feb 2,1853 > > Susanna, born March 18, 1855 > > William John, born Dec 31, 1856 > > Harriet, born April 3, 1860 > > Samuel, born Feb 26, 1863 > > Charlotte, born March 6, 1866 > > Annie Elizabeth, born March 18,1869 > > > > We have no information on any of their children, except William, the first > born. > > We have found a marriage for Catherine Dolton, spinster, St Johns, to > Thomas > Ryans (Ryan), bach., Pouch Cove on Oct 19,1872. Witnesses were > > Samuel Honeywell and William Hewardine. This may be our Catherine > Theresa, > but we have been unable to confirm that. > > > > We are hoping that someone may be able to help us find more information > on > William and Susanna. Our best hope now seems to be to find a death record > or burial information. We believe from information in city directories, > that > William died sometime in 1897/1898. Susanna died sometime after 1904. When > William, their son, died in Lynn, Mass. in 1904, his obituary stated that > he > was survived by and aged mother and 2 sisters in St Johns, Newfoundland. > > We do not know which 2 sisters. More than likely they were married, so an > obituary for William or Susanna might tell us their names. > > > > We also do not know when or where in England William was born, so that > makes > it nearly impossible to identify his parents. > > > > Does anyone know in which newspaper we would be most likely to find an > obituary and how it can be accessed ? > > > > We would appreciate any information that you have on any of these people > above. > > > > Thanks in advanced for any informaion that may be provided to us. > > > > Art Dalton > > Sanford, ME. > > > > > > > > > ------------------------------- > To unsubscribe from the list, please send an email to > [email protected] with the word 'unsubscribe' without the > quotes in the subject and the body of the message >

    11/11/2006 11:21:05
    1. Re: [NFLD-LAB] DNA primer
    2. David Pike
    3. Judy, I am so sorry that you have been disappointed, and that you feel that the DNA test was not [yet] worthwhile. In isolation, a DNA result is (as you realise) of little value. The results really take on meaning when compared with other people. Since 2004 I've been voluntarily coordinating a DNA project for the Pike family, so that we might be able to use genetic analysis to help distinguish between different family lines, and also to discover which family lines are connected to each other. We now have over 50 people involved, from 4 different continents, and have discovered that there are at least 19 genetically distinct Pike family lines. Of interest to the readers of this list will be that we so far have only 4 Nfld Pikes involved, each with roots from Carbonear, and these 4 have been shown to be related ... we're actually quite excited about this since for some of us we cannot find written records to show that we are related. Also of interest is that we have not yet found any Pikes elsewhere who genetically match the Carbonear crowd... my hope is that we will make a connection someday, as that may help shed some light on the origins of the Pikes of Carbonear. I'm also hoping that we'll get more Nfld & Lab Pikes involved, such as those from the Burin Peninsula, from Old Perlican, Red Bay, etc, so that we can find out if we are all one big Pike family, or if there are multiple Pike family lines [my personal suspicion is that Nfld is home to multiple Pike family lines]. Anybody interested in the Pike family can find our DNA project (plus lots of other Pike information) on my website at http://www.math.mun.ca/~dapike/family_history/ Judy, if your brother is a Corbett, then if you go to http://www.worldfamilies.net/ you will find that there is a DNA project for the Corbett family. I would recommend that you try to get involved, as that's the best place to be comparing your DNA with other Corbetts. You might also consider entering your brother's DNA markers into the public database at http://www.ysearch.org as this is another way that you might find genetic matches (especially with people of differing surnames). You can also search for genetic matches at http://www.smgf.org For other folks who are contemplating getting involved with genetic genealogy, I have a number of recommendations. The first is to get involved with the International Society of Genetic Genealogy. It is free, has a number resources online at http://www.isogg.org but especially has a wonderful mailing list/forum (plus more resources and links) at http://groups.yahoo.com/group/DNA-NEWBIE/ For those wanting to trace their direct paternal line, seek out a project for the corresponding surname. There are a number of companies out there that do genetic testing for genealogists, and if your surname has a project with one of them, then it might be difficult to compare your DNA results if you test with a different company. A few places where you can search for surname-based DNA projects are: http://www.worldfamilies.net/ http://www.familytreedna.com/ http://dnaheritage.com/ If your surname has no project, then it's worth noting that several of these entities also provide some assistance with creating one (that is, if you're willing to take on the task of coordinating one)... you might also be interested in checking out this list/forum http://groups.yahoo.com/group/ISOGG/ which often discusses issues of interest to project coordinators. Be aware that there are a number of other companies that are happy to take your money and provide you with DNA results, but as I said earlier, unless you will be able to compare those results with other people then there really is little value to be had. Some companies are really good about telling you who match with, while others are not; which you test with will likely impact on how you feel about your experience with genetic genealogy. Changing topics slightly now, from paternal ancestry (and Y-DNA) to maternal ancestry (and mtDNA), I would like to also take a brief moment to announce that a Newfoundland and Labrador mtDNA Project has been recently established. It's website is at http://www.familytreedna.com/public/NfldLab-mtDNA - David. > From: [email protected] > Subject: Re: [NFLD-LAB] DNA primer > Date: Sat, 4 Nov 2006 18:09:13 EST > > I spent $118 on this test. I had my brother do the cheek swab as we are > tracing the male line. However, it seems like a big waste of money since they don't > tell you who you are connected to. I was very disappointed. They give you 44 > markers (these are letters like DYS19 etc. You will get 44 of such. No way to > tell if you are connected to anyone unless you know people who have done the > test and are probably related to you. My grandfather was from Chapel's Cove. > I suspect that anyone from Harbour Main or Chapel's Cove would have similar > DNA to myself and my brother. However, until everyone is tested, we won't know. > Here is the link to the site where I went. > It is called www.Genebase.com > Good luck, > Judy > > Judy Corbett Barker > St. Petersburg, Florida and Holyrood, Newfoundland, Canada > Researching the Channel Islands, Ireland, Newfoundland and New Jersey.

    11/11/2006 05:33:55
    1. Re: [NFLD-LAB] DNA primer
    2. To David and anyone else that might have information. After reading your email, I did a web search and came across the following website. Do you have any experience or way of know if this is something that would be worthwhile to participate in? pages.sbcglobal.net/jimsims/sims/sims-Y-project/SimsSignatures-elsewhere.htm It was found at the following website, http://www.familytreedna.com/surname_join.asp?code=J87323&special=True&projecttype=S -----Original Message----- From: [email protected] To: [email protected]; [email protected] Sent: Sat, 11 Nov 2006 11:17 AM Subject: Re: [NFLD-LAB] DNA primer Dear David, Many thanks for the leads in this DNA project. I guess I should have started on another site but I had an ad online from Genebase.com and they are of no help once you pay the $118. When I went to FamilyTree, they would not accept this DNA and wanted me to retest for $150. So I was dismayed. I felt as though I was an isolated case CORBETT DNA in hopes of finding links. Doing the genealogy/family tree is one thing, but finding genetic matches must be thrilling. Judy Judy Corbett Barker St. Petersburg, Florida and Holyrood, Newfoundland, Canada Researching the Channel Islands, Ireland, Newfoundland and New Jersey. Visit my website at http://members.aol.com/judyb3753/index.html ------------------------------- To unsubscribe from the list, please send an email to [email protected] with the word 'unsubscribe' without the quotes in the subject and the body of the message ________________________________________________________________________ Check out the new AOL. Most comprehensive set of free safety and security tools, free access to millions of high-quality videos from across the web, free AOL Mail and more.

    11/11/2006 04:34:09
    1. Re: [NFLD-LAB] DNA primer
    2. Dear David, Many thanks for the leads in this DNA project. I guess I should have started on another site but I had an ad online from Genebase.com and they are of no help once you pay the $118. When I went to FamilyTree, they would not accept this DNA and wanted me to retest for $150. So I was dismayed. I felt as though I was an isolated case CORBETT DNA in hopes of finding links. Doing the genealogy/family tree is one thing, but finding genetic matches must be thrilling. Judy Judy Corbett Barker St. Petersburg, Florida and Holyrood, Newfoundland, Canada Researching the Channel Islands, Ireland, Newfoundland and New Jersey. Visit my website at http://members.aol.com/judyb3753/index.html

    11/11/2006 04:17:49
    1. [NFLD-LAB] (no subject)
    2. Barbara
    3. Looking for any information in the McCabe surname in Conception Bay North area of the province. any help would be appreciated. thank you Barbara McCabe [email protected]

    11/10/2006 07:29:39