RootsWeb.com Mailing Lists
Next Page
Total: 20/32
    1. [mtDNAhgT] New Mailing List at Groups.io
    2. Aaron Hill
    3. This is the last day that mailing lists on RootsWeb will be functional. I have started a replacement list at Groups.io for MTDNA-HAPLOGROUP-T. Please join us there. https://groups.io/g/MTDNA-HAPLOGROUP-T Aaron Hill Seattle

    03/01/2020 08:57:47
    1. [mtDNAhgT] Mailing lists on RootsWeb will be disabled in March 2020
    2. Aaron Hill
    3. I am not happy about this. I received the following message this morning. Please protest this short-sighted move, if you want. Perhaps if they hear from enough us, Ancestry will reverse course. Aaron J. Hill aaronjhill.wordpress.com From RootsWeb Administration <rwmailinglists@ancestry.com> Tue 1/7/2020 9:36 AM Beginning March 2nd, 2020 the Mailing Lists functionality on RootsWeb will be discontinued. Users will no longer be able to send outgoing emails or accept incoming emails. Additionally, administration tools will no longer be available to list administrators and mailing lists will be put into an archival state. Administrators may save the emails in their list prior to March 2nd. After that, mailing list archives will remain available and searchable on RootsWeb. As an alternative to RootsWeb Mailing Lists, Ancestry message boards are a great option to network with others in the genealogy community. Message boards are available for free with an Ancestry registered account. Thank you for being part of the RootsWeb family and contributing to this community. Sincerely, The RootsWeb team

    01/07/2020 09:46:06
    1. [mtDNAhgT] New paper: 'Sephardic signature in haplogroup T mitochondrial DNA'
    2. Aaron Hill
    3. European Journal of Human Genetics (23 November 2011) doi:10.1038/ejhg.2011.200 http://www.nature.com/ejhg/journal/vaop/ncurrent/full/ejhg2011200a.html A rare combination of mutations within mitochondrial DNA subhaplogroup T2e is identified as affiliated with Sephardic Jews, a group that has received relatively little attention. Four investigations were pursued: Search of the motif in 250 000 control region records across 8 databases, comparison of frequencies of T subhaplogroups (T1, T2b, T2c, T2e, T4, T*) across 11 diverse populations, creation of a phylogenic median-joining network from public T2e control region entries, and analysis of one Sephardic mitochondrial full genomic sequence with the motif. It was found that the rare motif belonged only to Sephardic descendents (Turkey, Bulgaria), to inhabitants of North American regions known for secret Spanish–Jewish colonization, or were consistent with Sephardic ancestry. The incidence of subhaplogroup T2e decreased from the Western Arabian Peninsula to Italy to Spain and into Western Europe. The ratio of sister subhaplogroups T2e to T2b was found to vary 40-fold across populations from a low in the British Isles to a high in Saudi Arabia with the ratio in Sephardim more similar to Saudi Arabia, Egypt, and Italy than to hosts Spain and Portugal. Coding region mutations of 2308G and 14499T may locate the Sephardic signature within T2e, but additional samples and reworking of current T2e phylogenetic branch structure is needed. The Sephardic Turkish community has a less pronounced founder effect than some Ashkenazi groups considered singly (eg, Polish), but other comparisons of interest await comparable averaging. Registries of signatures will benefit the study of populations with a large number of smaller-size founders.

    11/27/2011 12:26:59
    1. [mtDNAhgT] 'Genetic Diversity among Ancient Nordic Populations'
    2. Aaron Hill
    3. New Research Article 'Genetic Diversity among Ancient Nordic Populations' http://www.plosone.org/article/info:doi/10.1371/journal.pone.0011898 "Material (teeth or hair) was sampled from 92 individuals from 18 locations in Denmark . . ." There are three haplogroup T samples (R1, Si9, K4). Si9 is from a Roman Iron Age settlement at Simonsborg and is subclade T2b. R1 is from the medieval cemetery at Riisby (AD 1250–1450) and is T2. K4 is just plain T. Abstract Using established criteria for work with fossil DNA we have analysed mitochondrial DNA from 92 individuals from 18 locations in Denmark ranging in time from the Mesolithic to the Medieval Age. Unequivocal assignment of mtDNA haplotypes was possible for 56 of the ancient individuals; however, the success rate varied substantially between sites; the highest rates were obtained with untouched, freshly excavated material, whereas heavy handling, archeological preservation and storage for many years influenced the ability to obtain authentic endogenic DNA. While the nucleotide diversity at two locations was similar to that among extant Danes, the diversity at four sites was considerably higher. This supports previous observations for ancient Britons. The overall occurrence of haplogroups did not deviate from extant Scandinavians, however, haplogroup I was significantly more frequent among the ancient Danes (average 13%) than among extant Danes and Scandinavians (~2.5%) as well as among other ancient population samples reported. Haplogroup I could therefore have been an ancient Southern Scandinavian type “diluted” by later immigration events. Interestingly, the two Neolithic samples (4,200 YBP, Bell Beaker culture) that were typed were haplogroup U4 and U5a, respectively, and the single Bronze Age sample (3,300–3,500 YBP) was haplogroup U4. These two haplogroups have been associated with the Mesolithic populations of Central and Northern Europe. Therefore, at least for Southern Scandinavia, our findings do not support a possible replacement of a haplogroup U dominated hunter-gatherer population by a more haplogroup diverse Neolithic Culture.

    08/01/2010 03:55:28
    1. [mtDNAhgT] Spencer Wells of The Genographic Project Completes Week of Lectures @ Cornell
    2. Aaron Hill
    3. 'Spencer Wells Explores Cornell' 'The Famous Geneticist Completes Week of Cornell Lectures' http://www.cornellsun.com/node/41410 Five years and over 400,000 samples later, . . . Dr. Spencer Wells . . . work re-traces humanity’s migrations over the past 60,000 years. Wells recently completed the first stage of the Genographic Project, collecting about 52,000 DNA samples . . . “Of course it is not exactly how I imagined it would be,” Wells said. He cited the 350,000 members of the public that purchased kits online as one of the project’s greatest successes. “It tells us about, not only the people you can name in your genealogy, but also people long before that, way back in history and people half way around the world, and how you’re connected to me,” he explained. The proceeds of the public participation DNA kits are being contributed to the Legacy Fund, which gives out grants for cultural initiatives and language preservation efforts. So far, the fund as distributed about $1.4 million to preserve cultural diversity. “In some ways … it’s a little bit to some people like reading tea leaves, it’s like you’re telling something magical, mystical about their past using these crazy, twenty-first-century technologies in human genetics.” There is an odd juxtaposition of old and new with the project, using high-tech, modern-day technology within the rich, indigenous landscape. The group uses DNA typing tools to answer historical and anthropological questions about the patterns of human diversity and migration. "We're at this amazing point in our study of genetics ... where we cannot only look at what has happened to us in the past, but we can actually actively contemplate changing the direction we’re going in,” Wells said. In a lecture on March 4, Wells described the relationship between science and the media. “What you have to do is make your science as compelling as possible,” expressed Wells. “I come at it as a practicing scientist, but also, as a storyteller in science.” The transition from scientist to communicator, Wells noted, is a wonderful privilege, but requires responsibility. Now that the first stage of Genographic Project is almost complete, Wells and his group are beginning to analyze all the data. The thing that continuously surprises him is how recently Homo sapiens left Africa. According to data, humanity was isolated to Africa until only about 65,000 years ago. Wells still finds this to be the most amazing, revolutionary result.

    03/11/2010 09:21:03
    1. [mtDNAhgT] 'Genome work ushers in new genetic era'
    2. Aaron Hill
    3. Two research teams have independently decoded the entire genome of patients to find the exact genetic cause of their diseases. The approach may offer a new start in the so far disappointing effort to identify the genetic roots of major killers like heart disease, diabetes and Alzheimer’s. http://www.nytimes.com/2010/03/11/health/research/11gene.html Two studies published on Wednesday show it is possible to sequence the entire gene maps of families with inherited diseases and pinpoint the offending bit of DNA. http://www.reuters.com/article/idUSTRE6295J820100310 Jim Lupski was luckier than his older brother, who even before his 5th birthday lost the ability to run and walked only with exceptional pain. Doctors suspected muscular dystrophy. They were wrong. http://www.chron.com/disp/story.mpl/metropolitan/6907223.html Entire Family Genome Sequenced for First Time Children receive 30 mutations from each parent, researchers find http://www.businessweek.com/lifestyle/content/healthday/636874.html http://news.google.com/news/more?pz=1&cf=all&ned=us&ncl=dPsNDrnNmg6yNJMWbbg4bRx2d_UeM&topic=m -- Remember the days of old Consider the generations long past Ask your father He will show you Question the elders They will tell you They will teach you and explain The years of many generations Dig into the past, understand your roots Think about what has happened through those many years So that you may pass understanding from generation to generation — Deuteronomy 32:7* * (Note: This is my own compilation from a variety of translations.)

    03/10/2010 12:06:18
    1. [mtDNAhgT] Haplogroup T
    2. Mary Jefferson
    3. I just recently had my MTDNA done and it showed I belong to Haplogroup T. In reading more, I have discovered there are several Group T's! My results were this: Differences from the Revised Cambridge Reference Sequence >16294 T 16296 T 16304 C 16344 T 16519 C This is the whole sequence. >TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCC >ATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATAT >TGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATC >CACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCC >TCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAG >GATACCAACAAACCTACCCATCTTTAACAGCACATAGTACATAAAGCCAT >TTACCGTACATAGCACATTATAGTCAAATCCCTTCTCGTCCCCATGGATG >ACCCCCCTCAGATAGGGGTCCCTTGACCACCATCCTCCGTGAAATCAATA >TCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGGGG >GTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGCCATA >AAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGAC I am not too sure what this means. Is there something else I should have tested to clarify this or should I have one of my sons tested? Since all of this is my maternal line which I really don't have back too far (just six generations) and I think they were in Virginia in the early 1700s. Mary in Alaska

    06/26/2009 02:39:48
    1. Re: [mtDNAhgT] Posting, Questions & Comments
    2. Susan Rosine
    3. Hello there, Well, I don't have much to say at this point. It is my father who is in the mtDNA T haplogroup. He has some matches on HVR1, but none on HVR2. I am waiting for his FGS. They could not get results from the sample they had on file for him, so he just submitted a new sample. I'm not hoping for any matches, just interested in the deep ancestral roots of this side of my family. So, I would be interested in learning more about T--T1 in particular. Susan > Date: Sun, 8 Mar 2009 02:16:14 +0000 > From: Aaron Hill <mrmayor@hotmail.com> > Subject: [mtDNAhgT] Posting, Questions & Comments > To: <mtdna-haplogroup-t@rootsweb.com> > Message-ID: <BLU146-W21E6095FB53945037413A7B8A30@phx.gbl> > Content-Type: text/plain; charset="Windows-1252" > > > Please feel free to post any queries and questions. The more information that is shared, the greater opportunity for knowledge. > > I am preparing some reporting and analysis. > > AJH

    03/09/2009 03:13:18
    1. [mtDNAhgT] Posting, Questions & Comments
    2. Aaron Hill
    3. Please feel free to post any queries and questions. The more information that is shared, the greater opportunity for knowledge. I am preparing some reporting and analysis. AJH _________________________________________________________________ Windows Live™ Contacts: Organize your contact list. http://windowslive.com/connect/post/marcusatmicrosoft.spaces.live.com-Blog-cns!503D1D86EBB2B53C!2285.entry?ocid=TXT_TAGLM_WL_UGC_Contacts_032009

    03/07/2009 07:16:14
    1. [mtDNAhgT] T1b
    2. John Dyer
    3. I am partially testing the system, partially raising a question. I predict I am T1b although I have just taken the low resolution test from FTDNA and been identified as T*. Why? Because I belong to the Bahamas project where I learned some relevant info. I belong to that project because my mother, grandmother, great grandmother and presumably her mother came from the Bahamas. There I have five matches in that project who took the high resolution test as well as the low resolution test I took, including a known 2d cousin descendant of my great grandmother. That is how I predict T1b for me without having taken the high resolution test yet. Outside of that project, on my low resolution test, FTDNA calculates my nearest matches come from Italy, the Balkans, Syria, Germany. I have noticed and it has been pointed out to me there is an association with the Nederlands and the Vikings of some T, although no one has specifically said T1b. I have noted many of the related Bahamian men are I1a also, which would fit the profile. But I have found nothing that addresses more detail than T, T1, T2, T3, T4, T5 and very little on anything other than T1 and T2. Nothing on T1b. The family tradition is that all of my Bahamian relatives came from the UK. That in of itself is not at odds with the Viking theory. However, the low resolution matches are resonating with me. I do realize that this is an ancient group and it may not mean a lot that i have the matches I have. So, what I am looking for in many places is more info specifically on T1b. Not technical info because I just have a difficult time grasping it. I am essentially interested in tribal affiliations. _________________________________________________________________ Reveal your inner athlete and share it with friends on Windows Live. http://revealyourinnerathlete.windowslive.com?locale=en-us&ocid=TXT_TAGLM_WLYIA_whichathlete_us

    08/03/2008 04:06:42
    1. [mtDNAhgT] T* with odd mutation
    2. Adrienne Uphoff
    3. I'm haplogroup T* with mutations at the usual T sites (16126 C, 16294 T, and 16519 T) and also 16296 T and 16356 C--I've looked around online at others' profiles and have yet to see the last mutation in other Ts. Anyone know what this means? Anyone else have these? Also, anyone else's maternal line from the Netherlands? We've been here since the very beginning (mid 1600s) in New Amsterdam. Adrienne

    07/19/2008 03:17:28
    1. Re: [mtDNAhgT] mtdna and famous male ancestors
    2. Diana Gale Matthiesen
    3. I have a pedigree of Jesse JAMES at my web site: http://dgmweb.net/genealogy/Pedigrees/0/JJ1-JesseJames.shtml His matrilineal line (the path of his mtDNA descent) is: Ann (HUBBARD) COLE of PA and Woodford Co., KY _Alice (COLE) LINDSAY __Sallie (LINDSAY) COLE ___Zerelda (COLE) JAMES ____Jesse Woodson JAMES mtDNA haplogroups are very large, old groups (most are thousands of years old). Just because you are the same mtDNA haplogroup as someone else doesn't mean you would necessarily find a connection in "genealogical time" (i.e., in the last 500 years or so). Diana > -----Original Message----- > From: mtdna-haplogroup-t-bounces@rootsweb.com On Behalf Of J sauntry > Sent: Friday, May 02, 2008 8:43 PM > To: mtdna-haplogroup-t@rootsweb.com > Subject: [mtDNAhgT] mtdna and famous male ancestors > > I have a question, my cousin was DNA tested so we could find > out more about our maternal ggg grandmother. Barb is T2 and > it came back famous relatives were > Tsar Nicholas and Jessie James Now these are men and we > are testing MTDNA. > > How do we get to these men part of our haplogroup T2? > > Our ggg grandmother was Mary Jane Freeman born Oct 20 1834 , > Maine and her parents were Dennis Freeman b 1789 Maine and > his wife Mary Briggs b 1801Vermont > > Jeannette > >

    05/03/2008 06:36:06
    1. [mtDNAhgT] mtdna and famous male ancestors
    2. Aaron Hill
    3. Furthermore, just to explain, I am T1a. I would not have established this list if I didn't have some personal role in the subject. For a few years now I have been very involved in researching yDNA, particularly the group commonly known as I1a (now merely I1), neglecting my mtDNA, to my detriment. I didn't think I had been tested, but then realized that Sorenson, http://www.smgf.org, probably did test both my mtDNA and yDNA. When I checked the database, sure enough my results and those of my younger brother were there. Often I had used the Y chromosome database and ignored the other. After some trouble deciphering and interpreting the results, I then input the information into Genebase, http://www.genebase.com, or Genetree, http://www.genetree.com, and it came back that I was haplogroup T. I have since joined the T1a Project, http://www.worldfamilies.net/mtdna/t1/index.html. And the really good news: it was free! -- Aaron _________________________________________________________________ Stay in touch when you're away with Windows Live Messenger. http://www.windowslive.com/messenger/overview.html?ocid=TXT_TAGLM_WL_Refresh_messenger_052008

    05/02/2008 09:13:55
    1. Re: [mtDNAhgT] mtdna and famous male ancestors
    2. Aaron Hill
    3. Everyone, men and women, has mitochondrial DNA (mtDNA). It is inherited from the mother. Only men have the yDNA (the Y chromosome). Both yDNA and mtDNA are called non-recombining, meaning the genes do not mix with others (except in extremely rare cases). This is unlike the female X chromosome, which does recombine as well as the rest of the human genome. This is called autosomal DNA (or sometimes aDNA). Be careful though when reading as aDNA also means ancient DNA. http://en.wikipedia.org/wiki/Human_mitochondrial_genetics http://en.wikipedia.org/wiki/MTDNA Aaron > Date: Fri, 2 May 2008 20:43:05 -0400 > From: jrapleysauntry@yahoo.ca > To: mtdna-haplogroup-t@rootsweb.com > Subject: [mtDNAhgT] mtdna and famous male ancestors > > I have a question, my cousin was DNA tested so we could find out more about our maternal ggg grandmother. Barb is T2 and it came back famous relatives were Tsar Nicholas and Jesse James Now these are men and we are testing MTDNA. > > How do we get to these men part of our haplogroup T2? > > Jeannette _________________________________________________________________ Stay in touch when you're away with Windows Live Messenger. http://www.windowslive.com/messenger/overview.html?ocid=TXT_TAGLM_WL_Refresh_messenger_052008

    05/02/2008 07:06:20
    1. [mtDNAhgT] mtdna and famous male ancestors
    2. J sauntry
    3. I have a question, my cousin was DNA tested so we could find out more about our maternal ggg grandmother. Barb is T2 and it came back famous relatives were Tsar Nicholas and Jessie James Now these are men and we are testing MTDNA. How do we get to these men part of our haplogroup T2? Our ggg grandmother was Mary Jane Freeman born Oct 20 1834 , Maine and her parents were Dennis Freeman b 1789 Maine and his wife Mary Briggs b 1801Vermont Jeannette --------------------------------- Be smarter than spam. See how smart SpamGuard is at giving junk email the boot with the All-new Yahoo! Mail

    05/02/2008 02:43:05
    1. Re: [mtDNAhgT] Questions & Issues?
    2. Aaron Hill
    3. Yes. > From: DianaGM@dgmweb.net > To: mtdna-haplogroup-t@rootsweb.com > Date: Tue, 29 Apr 2008 14:01:27 -0400 > Subject: Re: [mtDNAhgT] Questions & Issues? > > Just for future reference... Are you the listadmin? > > Diana _________________________________________________________________ Make i'm yours.  Create a custom banner to support your cause. http://im.live.com/Messenger/IM/Contribute/Default.aspx?source=TXT_TAGHM_MSN_Make_IM_Yours

    04/30/2008 01:37:40
    1. Re: [mtDNAhgT] Questions & Issues?
    2. Diana Gale Matthiesen
    3. Just for future reference... Are you the listadmin? Diana > -----Original Message----- > From: mtdna-haplogroup-t-bounces@rootsweb.com On Behalf Of Aaron Hill > Sent: Monday, April 28, 2008 9:09 PM > To: mtdna-haplogroup-t@rootsweb.com > Subject: [mtDNAhgT] Questions & Issues? > > Does anyone have any questions, problems, or issues? Just post away. > > -- Aaron > >

    04/29/2008 08:01:27
    1. [mtDNAhgT] Questions & Issues?
    2. Aaron Hill
    3. Does anyone have any questions, problems, or issues? Just post away. -- Aaron _________________________________________________________________ Back to work after baby–how do you know when you’re ready? http://lifestyle.msn.com/familyandparenting/articleNW.aspx?cp-documentid=5797498&ocid=T067MSN40A0701A

    04/28/2008 07:08:37
    1. Re: [mtDNAhgT] Classifying T haplotypes at GeneTree
    2. Michael Maddi
    3. A few days ago I started this thread by posting GeneTree's reply to my question about why they regard me as T2, while FTDNA (based on HVR1 mutations) has classified me as T5. Here is Bennett Greenspan's reply to my forwarding GeneTree's e-mail to him: We are using a technical protocol that we developed 3 years ago...and no definitive work has been done on T2 so we are still showing you as T5, however David Pike is working with us to create a T* project that will focus only on FGS data and we expect that work and paper will clear this up, and yes I have seen 3-4 people called T5 who have been reclassified as T2 and you might fall into that category but until the work on FGS for T* is complete we'll leave the T5 classification alone. So, it's obvious that FTDNA can not resolve the issue for T5's without an FGS. I hope to order that test sometime later this year. Mike ____________________________________________________________________________________ Looking for last minute shopping deals? Find them fast with Yahoo! Search. http://tools.search.yahoo.com/newsearch/category.php?category=shopping

    01/20/2008 03:32:38
    1. [mtDNAhgT] How to Read SMGF mtDNA Results
    2. Aaron Hill
    3. Actually SMGF has written me that the gray results have been tested on the given participant. Being gray simply means that it matches with the CRS, Cambridge Reference Sequence, which as the first mtDNA studied comprehensively. The black results are mutations from the CRS. If this is not clear, please let me know and I will work on explaining it better. Aaron _________________________________________________________________ Need to know the score, the latest news, or you need your Hotmail®-get your "fix". http://www.msnmobilefix.com/Default.aspx

    01/19/2008 04:33:35