The above was a third marker in the Howle-Degnen group, it was first found in hg J by Greg Magoon. It is now also on sale at YSEQ along with A259 and A260. Because it has recurred it now appears three times in the catalogue as FGC5939, FGC5939.1 and FGC5939.2. Only the last of these makes reference to M222/S660 (although underneath they all represent the same physical test). If anyone orders it please use the FGC5939.2 version just to make the records clear. FGC5939.2 [FGC5939.2] FGC5939.2 HG19 Position: ChrY:16453662..16453662 Ancestral: C Derived: T Reference: Iain Kennedy (2014 ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed) Comments: Downstream R1b-M222/S660 Forward Primer: FGC5939_F GCTATTAATAAATCTAAGGCCCTCCA Reverse Primer: FGC5939_R CACAACCATTAATGCAGCCAT Iain