That's right Rob. Any time someone mentions a SNP on the list, just find its position and look it up and see what value you have for it. BigY people can't do that to the same extent as their coverage is much less. FGC sequences as much as is possible to do. Iain > Date: Wed, 30 Apr 2014 02:30:52 +0000 > From: rob@themcfaddenproject.com > To: dna-r1b1c7@rootsweb.com > Subject: Re: [R-M222] Full Genomes vs. Big Y > > Ian, > > If I take the Full Genomes test, theoretically I wouldn't ever need to > take any more Y tests. Is that correct? > > Quoting Iain Kennedy <ikennedy_msdn2@hotmail.com>: > > > Position wise the coverage is far superior: for example only 50% of > > my FGC SNPs are being sequenced by BigY and about two thirds of > > David Wilson's. > > Although I haven't measured it I have the impression there are often > > more reads on BigY per position but there are so many anyway that is > > less of an issue - in fact Greg Magoon told me right at the start > > that for novel variants even one good read is sufficient. > > The post-sequencing analysis is far superior. > > > > I wouldn't hesitate if I was in your position. > > > > Iain > > > > > > > > > > > > > >> Date: Sun, 27 Apr 2014 11:19:55 +0000 > >> From: rob@themcfaddenproject.com > >> To: DNA-R1B1C7@rootsweb.com > >> Subject: [R-M222] Full Genomes vs. Big Y > >> > >> > >> I'm genuinely considering taking advantage of the $999 Full Genomes > >> offer, but I won't be making that decision lightly. I'm under the > >> impression that it is meant to be all-encompassing and that I wouldn't > >> need to take another Y STR or SNP test ever again. Is this true? How > >> are the results that have come through so far holding up? Any quality > >> concerns? > >> > >> Is it too early to judge the value of the Big Y test in comparison? > >> > >> Thanks, > >> Rob McFadden > >> S660+ > >> > > > ------------------------------- > To unsubscribe from the list, please send an email to DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the quotes in the subject and the body of the message

I see the last 12 markers of that string didn't make it example 2 393 390 394 391 385a 385b 426 388 439 389-1 392 389-2 458 459a 459b 455 454 447 437 448 449 464a 464b 464c 464d 13 25 14 11 11 13 12 12 12 13 14 29 17 9 10 11 11 25 15 18 30 15 16 16 17 460 G H4 Y Iia Y Iib 456 607 576 570 CDYa CDYb 442 438 11 11 19 23 17 16 18 17 38 39 12 12

Hi Bret, If you wouldn't mind sending me your haplotype. Please make certain that the DYS labels are over each locus. Here is an example: This is FTDNA's 37 marker format. 393 390 394 391 385a 385b 426 388 439 389-1 392 389-2 458 459a 459b 455 454 447 437 448 449 464a 464b 464c 464d 13 25 14 11 11 13 12 12 12 13 14 29 17 9 10 11 11 25 15 18 30 15 16 16 17 YSEQ is a good vendor. The principals are Thomas and Astrid Krahn. You could probably do a google search on them if you were curious. Both are highly respected geneticists; both formerly employed by FTDNA up until last year, Thomas being their chief Science Officer. YSEQ is his second genetics business as he owned/operated another that FTDNA bought out. I hope you find this helpful Susan Hedeen

Ian, If I take the Full Genomes test, theoretically I wouldn't ever need to take any more Y tests. Is that correct? Quoting Iain Kennedy <ikennedy_msdn2@hotmail.com>: > Position wise the coverage is far superior: for example only 50% of > my FGC SNPs are being sequenced by BigY and about two thirds of > David Wilson's. > Although I haven't measured it I have the impression there are often > more reads on BigY per position but there are so many anyway that is > less of an issue - in fact Greg Magoon told me right at the start > that for novel variants even one good read is sufficient. > The post-sequencing analysis is far superior. > > I wouldn't hesitate if I was in your position. > > Iain > > > > > > >> Date: Sun, 27 Apr 2014 11:19:55 +0000 >> From: rob@themcfaddenproject.com >> To: DNA-R1B1C7@rootsweb.com >> Subject: [R-M222] Full Genomes vs. Big Y >> >> >> I'm genuinely considering taking advantage of the $999 Full Genomes >> offer, but I won't be making that decision lightly. I'm under the >> impression that it is meant to be all-encompassing and that I wouldn't >> need to take another Y STR or SNP test ever again. Is this true? How >> are the results that have come through so far holding up? Any quality >> concerns? >> >> Is it too early to judge the value of the Big Y test in comparison? >> >> Thanks, >> Rob McFadden >> S660+ >>

Anyone contemplating FGC (Full Genomes)...listen up The discount to $999.00 is good for 24 hours. On Apr 29, 2014, at 8:11 PM, "G. Magoon" <gregm4584@gmail.com <mailto:gregm4584@gmail.com>> wrote: Susan, I just asked Justin and they are planning on leaving the FGC sale open until the end of the month (i.e. about 24 hours more). The sale code is: FGCDNA So, anyone considering the full scale FGC test, you have about 24 hours as Greg says to use the FGCDNA coupon code to get a $1250 test for $999. Susan On 4/29/2014 10:30 PM, Rob McFadden wrote: > Ian, > > If I take the Full Genomes test, theoretically I wouldn't ever need to > take any more Y tests. Is that correct? > > Quoting Iain Kennedy <ikennedy_msdn2@hotmail.com>: > >> Position wise the coverage is far superior: for example only 50% of >> my FGC SNPs are being sequenced by BigY and about two thirds of >> David Wilson's. >> Although I haven't measured it I have the impression there are often >> more reads on BigY per position but there are so many anyway that is >> less of an issue - in fact Greg Magoon told me right at the start >> that for novel variants even one good read is sufficient. >> The post-sequencing analysis is far superior. >> >> I wouldn't hesitate if I was in your position. >> >> Iain >> >> >> >> >> >> >>> Date: Sun, 27 Apr 2014 11:19:55 +0000 >>> From: rob@themcfaddenproject.com >>> To: DNA-R1B1C7@rootsweb.com >>> Subject: [R-M222] Full Genomes vs. Big Y >>> >>> >>> I'm genuinely considering taking advantage of the $999 Full Genomes >>> offer, but I won't be making that decision lightly. I'm under the >>> impression that it is meant to be all-encompassing and that I wouldn't >>> need to take another Y STR or SNP test ever again. Is this true? How >>> are the results that have come through so far holding up? Any quality >>> concerns? >>> >>> Is it too early to judge the value of the Big Y test in comparison? >>> >>> Thanks, >>> Rob McFadden >>> S660+ >>> > > ------------------------------- > To unsubscribe from the list, please send an email to DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the quotes in the subject and the body of the message >

Hi Susan, This is getting interesting, but my supplies of popcorn are beginning to run low. Keep up the good work. Malcolm. On 29 Apr 2014, at 18:00, Susan Hedeen <chantillycarpets@earthlink.net> wrote: > Very good...there have been some notices of other changes as well in > regard to the reporting of GENO2. > The entire community in addition to R-M222 were somewhat alarmed and > FTDNA did get feed back from > a plethora of people and groups. I am happy that they are using the > feed back to improve things. > > In regard to SNP testing, our R-M222 haplogroup project is more aware of > what is going on with R-M222 > than other groups and the vendors at the moment although some of the > vendors are more aware than others. > If project members and others have questions, it may be best to bring > them to the list. If none on the list or those > among us that are working the data have the answers, most of us will go > the extra steps to learn more. > > None of us may claim that we know it all, but I believe we may say that > we take your information, > consider it against the evidences of SNPs and STRs, and the testing > there of that we have, and relate what we think the possibilities are in > addition to > saying what does or doesn't make sense. Susan > > On 4/29/2014 12:33 PM, Kyle DePew wrote: >> Correction: I see now that I am listed as Z70-. >> >> >> > > > ------------------------------- > To unsubscribe from the list, please send an email to DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the quotes in the subject and the body of the message

The above was a third marker in the Howle-Degnen group, it was first found in hg J by Greg Magoon. It is now also on sale at YSEQ along with A259 and A260. Because it has recurred it now appears three times in the catalogue as FGC5939, FGC5939.1 and FGC5939.2. Only the last of these makes reference to M222/S660 (although underneath they all represent the same physical test). If anyone orders it please use the FGC5939.2 version just to make the records clear. FGC5939.2 [FGC5939.2] FGC5939.2 HG19 Position: ChrY:16453662..16453662 Ancestral: C Derived: T Reference: Iain Kennedy (2014 ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed) Comments: Downstream R1b-M222/S660 Forward Primer: FGC5939_F GCTATTAATAAATCTAAGGCCCTCCA Reverse Primer: FGC5939_R CACAACCATTAATGCAGCCAT Iain

I double checked and there was one with an S alias, the full breakdown is as follows: one with S alias on Chromo2: CTS6 (S3403),02657349,T,C others on Chromo2 with original name: CTS8002,17792632,C,A CTS8580,18091777,A,G CTS9501,18937926,C,T F3952,16945894,A,G M226,15591447,C,T PF3292,08519704,G,A only on Geno 2: CTS10488,19479797,G,T CTS11548,23159136,G,A CTS12173,28505799,C,A CTS3771,15167624,G,A F1033,07643777,C,T F1400,08764464,T,G F1636,09877607,G,A F1732,14222412,C,T F3024,19345100,C,A F3637,24442752,C,T F499,18657388,A,G PF1909,23618826,C,T PF2028,07634867,G,A PF3988,13238818,G,T PF7301,07844023,T,C PF910,18092491,T,C Z70,15424632,C,T Iain > Date: Tue, 29 Apr 2014 07:05:30 -0500 > From: mwwdna@gmail.com > To: dna-r1b1c7@rootsweb.com > Subject: Re: [R-M222] Advice on further testing > > Thank you, Iain. Yes, please shows us the position numbers and allele > changes. Does FTDNA have this on a web link somewhere or do you have to > look this up one by one? > > > On Tue, Apr 29, 2014 at 12:29 AM, Iain Kennedy > <ikennedy_msdn2@hotmail.com>wrote: > > > There is no overlap between this latest list of SNPs and S class SNPs. > > > > If anyone wants a list of the positions of the ones FTDNA are pushing let > > me know, to save you looking them all up. > > > > > > Iain > > > > > > > > > > > > > Date: Mon, 28 Apr 2014 16:38:14 -0700 > > > From: cecinit2007@gmail.com > > > To: dna-r1b1c7@rootsweb.com > > > Subject: Re: [R-M222] Advice on further testing > > > > > > I re-checked the FTNDA haplo tree for Mark Donnelly today, & it's > > > working (no response from the helpdesk yet tho). > > > > > > It now says uncle Mark's haplotype is > > > R-PF2028 > > > and recommends PF1909. > > > > > > Any more info on them? Do they match any of the S* > > > or others used here: > > > http://www.kennedydna.com/M222.pdf > > > > > > I'm on mobile today so can't do much lookup, but > > > don't see much for these PF things. > > > > > > > > > On Sun, Apr 27, 2014 at 11:18 PM, Iain Kennedy > > > <ikennedy_msdn2@hotmail.com>wrote: > > > > > > > I think you need to plan quite smartly, the sale price at yseq runs > > until > > > > Fathers Day and their tests *usually* take about 3-4 weeks to return > > so you > > > > will probably squeeze in two rounds before the price goes back up. So > > one > > > > idea would be to do the gambling on S7814 then if that fails go back > > up to > > > > the big branches as Susan had outlined. But its really up to you. > > There has > > > > been quite a lot of talk about the history of S7814 but a lot of it is > > > > based on singleton surname results. > > > > > > > > The 'worst' place to be is S588 as that's the bushiest part of the > > tree to > > > > refine. If you end up there and have to resolve it SNP by SNP you would > > > > probably have been better off using Chromo2. > > > > > > > > Iain > > > > > > > > > > > > > > > > > > > > > > > > > Date: Sun, 27 Apr 2014 17:51:35 -0700 > > > > > From: cecinit2007@gmail.com > > > > > To: dna-r1b1c7@rootsweb.com > > > > > Subject: Re: [R-M222] Advice on further testing > > > > > > > > > > On Sun, Apr 27, 2014 at 5:36 PM, Michael Helm <cecinit2007@gmail.com > > > > > > > wrote: > > > > > > > > > > > > is S7814 an accessible SNP test, > > > > > > > > > > > I see it in yseq's catalog so a test there is available - good > > gamble? > > > > > > > > > > ------------------------------- > > > > > To unsubscribe from the list, please send an email to > > > > DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without > > the > > > > quotes in the subject and the body of the message > > > > > > > > > > > > ------------------------------- > > > > To unsubscribe from the list, please send an email to > > > > DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without > > the > > > > quotes in the subject and the body of the message > > > > > > > > > > ------------------------------- > > > To unsubscribe from the list, please send an email to > > DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the > > quotes in the subject and the body of the message > > > > > > ------------------------------- > > To unsubscribe from the list, please send an email to > > DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the > > quotes in the subject and the body of the message > > > > ------------------------------- > To unsubscribe from the list, please send an email to DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the quotes in the subject and the body of the message

Very good...there have been some notices of other changes as well in regard to the reporting of GENO2. The entire community in addition to R-M222 were somewhat alarmed and FTDNA did get feed back from a plethora of people and groups. I am happy that they are using the feed back to improve things. In regard to SNP testing, our R-M222 haplogroup project is more aware of what is going on with R-M222 than other groups and the vendors at the moment although some of the vendors are more aware than others. If project members and others have questions, it may be best to bring them to the list. If none on the list or those among us that are working the data have the answers, most of us will go the extra steps to learn more. None of us may claim that we know it all, but I believe we may say that we take your information, consider it against the evidences of SNPs and STRs, and the testing there of that we have, and relate what we think the possibilities are in addition to saying what does or doesn't make sense. Susan On 4/29/2014 12:33 PM, Kyle DePew wrote: > Correction: I see now that I am listed as Z70-. > > >

Correction: I see now that I am listed as Z70-. On Tue, Apr 29, 2014 at 11:25 AM, Kyle DePew <kddepew@gmail.com> wrote: > I still have not received a response from FTDNA regarding my Z70+ result, > but I notice now that it no longer appears in my list of SNPs, and I am > back to R-M222 like the others. > > Kyle > > > On Mon, Apr 28, 2014 at 9:31 AM, Kyle DePew <kddepew@gmail.com> wrote: > >> Alright, thanks. I've sent an inquiry to FTDNA. I'll let you know what >> I get back. >> >> Kyle >> >> >> On Sun, Apr 27, 2014 at 10:37 PM, Susan Hedeen < >> chantillycarpets@earthlink.net> wrote: >> >>> Ancestral is ancestral. There may be a reporting glitch-- and it isn't >>> unheard of. >>> This is what I'd do...make note of the ancestral and the derived >>> states-- you should be able to copy paste that from Ybrowse. >>> Copy paste what the positive variant says >>> Copy paste what the raw data says--you have a copy? >>> Take it to FTDNA for clarification. Make them explain it. Susan >>> >>> On 4/27/2014 7:53 PM, Kyle DePew wrote: >>> > Thanks. So maybe my Z70+ is a mistake? Or just a difference of >>> opinion on >>> > which is ancestral? >>> > >>> > Kyle >>> > >>> > >>> > On Sun, Apr 27, 2014 at 6:28 PM, Michael Farrell <kullfarr@gmail.com> >>> wrote: >>> > >>> >> According to Ybrowse, C is ancestral, T is derived. >>> >> >>> >> >>> >> >>> http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse_details/chrY?ref=ChrY;start=15424632;end=15424632;name=Z70;class=Sequence;feature_id=34062;db_id=chrY%3Adatabase >>> >> >>> >> Mike >>> >> >>> >> On Apr 27, 2014, at 4:24 PM, Kyle DePew <kddepew@gmail.com> wrote: >>> >> >>> >>> Can anyone tell me what the ancestral and derived values for Z70 >>> are? My >>> >>> Geno 2 results say I have a "C" allele at that position. >>> >>> >>> >>> >>> >> >>> >> ------------------------------- >>> >> To unsubscribe from the list, please send an email to >>> >> DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without >>> the >>> >> quotes in the subject and the body of the message >>> >> >>> > ------------------------------- >>> > To unsubscribe from the list, please send an email to >>> DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the >>> quotes in the subject and the body of the message >>> > >>> >>> >>> ------------------------------- >>> To unsubscribe from the list, please send an email to >>> DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the >>> quotes in the subject and the body of the message >>> >> >> >

I still have not received a response from FTDNA regarding my Z70+ result, but I notice now that it no longer appears in my list of SNPs, and I am back to R-M222 like the others. Kyle On Mon, Apr 28, 2014 at 9:31 AM, Kyle DePew <kddepew@gmail.com> wrote: > Alright, thanks. I've sent an inquiry to FTDNA. I'll let you know what I > get back. > > Kyle > > > On Sun, Apr 27, 2014 at 10:37 PM, Susan Hedeen < > chantillycarpets@earthlink.net> wrote: > >> Ancestral is ancestral. There may be a reporting glitch-- and it isn't >> unheard of. >> This is what I'd do...make note of the ancestral and the derived >> states-- you should be able to copy paste that from Ybrowse. >> Copy paste what the positive variant says >> Copy paste what the raw data says--you have a copy? >> Take it to FTDNA for clarification. Make them explain it. Susan >> >> On 4/27/2014 7:53 PM, Kyle DePew wrote: >> > Thanks. So maybe my Z70+ is a mistake? Or just a difference of >> opinion on >> > which is ancestral? >> > >> > Kyle >> > >> > >> > On Sun, Apr 27, 2014 at 6:28 PM, Michael Farrell <kullfarr@gmail.com> >> wrote: >> > >> >> According to Ybrowse, C is ancestral, T is derived. >> >> >> >> >> >> >> http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse_details/chrY?ref=ChrY;start=15424632;end=15424632;name=Z70;class=Sequence;feature_id=34062;db_id=chrY%3Adatabase >> >> >> >> Mike >> >> >> >> On Apr 27, 2014, at 4:24 PM, Kyle DePew <kddepew@gmail.com> wrote: >> >> >> >>> Can anyone tell me what the ancestral and derived values for Z70 are? >> My >> >>> Geno 2 results say I have a "C" allele at that position. >> >>> >> >>> >> >> >> >> ------------------------------- >> >> To unsubscribe from the list, please send an email to >> >> DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without >> the >> >> quotes in the subject and the body of the message >> >> >> > ------------------------------- >> > To unsubscribe from the list, please send an email to >> DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the >> quotes in the subject and the body of the message >> > >> >> >> ------------------------------- >> To unsubscribe from the list, please send an email to >> DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the >> quotes in the subject and the body of the message >> > >

Thank you, Iain. Yes, please shows us the position numbers and allele changes. Does FTDNA have this on a web link somewhere or do you have to look this up one by one? On Tue, Apr 29, 2014 at 12:29 AM, Iain Kennedy <ikennedy_msdn2@hotmail.com>wrote: > There is no overlap between this latest list of SNPs and S class SNPs. > > If anyone wants a list of the positions of the ones FTDNA are pushing let > me know, to save you looking them all up. > > > Iain > > > > > > > Date: Mon, 28 Apr 2014 16:38:14 -0700 > > From: cecinit2007@gmail.com > > To: dna-r1b1c7@rootsweb.com > > Subject: Re: [R-M222] Advice on further testing > > > > I re-checked the FTNDA haplo tree for Mark Donnelly today, & it's > > working (no response from the helpdesk yet tho). > > > > It now says uncle Mark's haplotype is > > R-PF2028 > > and recommends PF1909. > > > > Any more info on them? Do they match any of the S* > > or others used here: > > http://www.kennedydna.com/M222.pdf > > > > I'm on mobile today so can't do much lookup, but > > don't see much for these PF things. > > > > > > On Sun, Apr 27, 2014 at 11:18 PM, Iain Kennedy > > <ikennedy_msdn2@hotmail.com>wrote: > > > > > I think you need to plan quite smartly, the sale price at yseq runs > until > > > Fathers Day and their tests *usually* take about 3-4 weeks to return > so you > > > will probably squeeze in two rounds before the price goes back up. So > one > > > idea would be to do the gambling on S7814 then if that fails go back > up to > > > the big branches as Susan had outlined. But its really up to you. > There has > > > been quite a lot of talk about the history of S7814 but a lot of it is > > > based on singleton surname results. > > > > > > The 'worst' place to be is S588 as that's the bushiest part of the > tree to > > > refine. If you end up there and have to resolve it SNP by SNP you would > > > probably have been better off using Chromo2. > > > > > > Iain > > > > > > > > > > > > > > > > > > > Date: Sun, 27 Apr 2014 17:51:35 -0700 > > > > From: cecinit2007@gmail.com > > > > To: dna-r1b1c7@rootsweb.com > > > > Subject: Re: [R-M222] Advice on further testing > > > > > > > > On Sun, Apr 27, 2014 at 5:36 PM, Michael Helm <cecinit2007@gmail.com > > > > > wrote: > > > > > > > > > > is S7814 an accessible SNP test, > > > > > > > > > I see it in yseq's catalog so a test there is available - good > gamble? > > > > > > > > ------------------------------- > > > > To unsubscribe from the list, please send an email to > > > DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without > the > > > quotes in the subject and the body of the message > > > > > > > > > ------------------------------- > > > To unsubscribe from the list, please send an email to > > > DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without > the > > > quotes in the subject and the body of the message > > > > > > > ------------------------------- > > To unsubscribe from the list, please send an email to > DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the > quotes in the subject and the body of the message > > > ------------------------------- > To unsubscribe from the list, please send an email to > DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the > quotes in the subject and the body of the message >

> Date: Mon, 28 Apr 2014 23:25:59 -0700 > From: cecinit2007@gmail.com > To: dna-r1b1c7@rootsweb.com > Subject: Re: [R-M222] Advice on further testing > > On Mon, Apr 28, 2014 at 10:29 PM, Iain Kennedy > <ikennedy_msdn2@hotmail.com>wrote: > > > There is no overlap between this latest list of SNPs and S class SNPs. > > > > If anyone wants a list of the positions of the ones FTDNA are pushing let > > me know, to save you looking them all up. > > > > Sure, that would be at least something to work with. > FTDNA is pushing one for me as well (I'm in DF21 - PF4252 .) > > Back to this group, I take it that these FTDNA SNPs are not very useful > at least at the moment. > That's a good summary of it. Iain

There is no overlap between this latest list of SNPs and S class SNPs. If anyone wants a list of the positions of the ones FTDNA are pushing let me know, to save you looking them all up. Iain > Date: Mon, 28 Apr 2014 16:38:14 -0700 > From: cecinit2007@gmail.com > To: dna-r1b1c7@rootsweb.com > Subject: Re: [R-M222] Advice on further testing > > I re-checked the FTNDA haplo tree for Mark Donnelly today, & it's > working (no response from the helpdesk yet tho). > > It now says uncle Mark's haplotype is > R-PF2028 > and recommends PF1909. > > Any more info on them? Do they match any of the S* > or others used here: > http://www.kennedydna.com/M222.pdf > > I'm on mobile today so can't do much lookup, but > don't see much for these PF things. > > > On Sun, Apr 27, 2014 at 11:18 PM, Iain Kennedy > <ikennedy_msdn2@hotmail.com>wrote: > > > I think you need to plan quite smartly, the sale price at yseq runs until > > Fathers Day and their tests *usually* take about 3-4 weeks to return so you > > will probably squeeze in two rounds before the price goes back up. So one > > idea would be to do the gambling on S7814 then if that fails go back up to > > the big branches as Susan had outlined. But its really up to you. There has > > been quite a lot of talk about the history of S7814 but a lot of it is > > based on singleton surname results. > > > > The 'worst' place to be is S588 as that's the bushiest part of the tree to > > refine. If you end up there and have to resolve it SNP by SNP you would > > probably have been better off using Chromo2. > > > > Iain > > > > > > > > > > > > > Date: Sun, 27 Apr 2014 17:51:35 -0700 > > > From: cecinit2007@gmail.com > > > To: dna-r1b1c7@rootsweb.com > > > Subject: Re: [R-M222] Advice on further testing > > > > > > On Sun, Apr 27, 2014 at 5:36 PM, Michael Helm <cecinit2007@gmail.com> > > wrote: > > > > > > > > is S7814 an accessible SNP test, > > > > > > > I see it in yseq's catalog so a test there is available - good gamble? > > > > > > ------------------------------- > > > To unsubscribe from the list, please send an email to > > DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the > > quotes in the subject and the body of the message > > > > > > ------------------------------- > > To unsubscribe from the list, please send an email to > > DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the > > quotes in the subject and the body of the message > > > > ------------------------------- > To unsubscribe from the list, please send an email to DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the quotes in the subject and the body of the message

On Mon, Apr 28, 2014 at 10:29 PM, Iain Kennedy <ikennedy_msdn2@hotmail.com>wrote: > There is no overlap between this latest list of SNPs and S class SNPs. > > If anyone wants a list of the positions of the ones FTDNA are pushing let > me know, to save you looking them all up. > Sure, that would be at least something to work with. FTDNA is pushing one for me as well (I'm in DF21 - PF4252 .) Back to this group, I take it that these FTDNA SNPs are not very useful at least at the moment. > > > > It now says uncle Mark's haplotype is > > R-PF2028 > > and recommends PF1909. > >

Hi Brenden, For all of the money, time and effort that you have spent, you at least are one of the M222 group, as now known. OK, so that is some progress. And that now gives you some information to work with. Technology and DNA research will continue to evolve, so be patient. Best, Doug On Mon, Apr 28, 2014 at 3:56 PM, B. Davitt <davittbrenden@gmail.com> wrote: > I just checked my FTDNA homepage (after sending in a couple of questions to > FTDNA) and they no longer have me listed as CTS 12173 but back to M222. > They also removed the "i" from my long hand haplogroup designation. > Brenden > > ------------------------------- > To unsubscribe from the list, please send an email to > DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the > quotes in the subject and the body of the message >

Hello all, my name is Brett Ward and I reside in Sydney, Australia. Mac a Bhaird (being Ward pre anglicised) as many of you will appreciate is an Irish occupational name (Bard, historian) and very old and reasonably prolific throughout Ireland. I can trace my family to about 1800 in Abington, County Limerick but the surname has its highest frequency in traditional ancestral locations within Galway and Tyrone. Ward is also a separate and unrelated English surname, but clearly causes much confusion. I have been watching DNA developments on this mailing list tentatively ever since having 37 STR markers mapped. This led me to test with Britains DNA (Ethnoancestry) a few years ago to ascertain that I was M222+. This then led me to look into Irish Ward DNA results and I would suggest that around 40-50% of Wards that I have seen are M222+. This may be little more than random for descendants from those West and North Western areas within Ireland. I have also recently just received my Chromo2 results from Britains DNA and am awaiting the raw file to be uploaded. They have a genetic signature page though that shows my 300 plus ‘positives’. Within Britains DNA tree, the lowest level I have achieved is S660, but I have aspirations! I have had a look at some trees, such as that to be found on the Kennedy website but do not seem to be able to find a lower level. As the song goes, where do I begin? Is there a useful guide somewhere for me to come up to speed quickly or some websites that I should hit first? I am very interested in pushing things along from a Ward angle. Thank you for reading and look forward to being a bit more active than the last few years, but that won’t be difficult. Brett

I re-checked the FTNDA haplo tree for Mark Donnelly today, & it's working (no response from the helpdesk yet tho). It now says uncle Mark's haplotype is R-PF2028 and recommends PF1909. Any more info on them? Do they match any of the S* or others used here: http://www.kennedydna.com/M222.pdf I'm on mobile today so can't do much lookup, but don't see much for these PF things. On Sun, Apr 27, 2014 at 11:18 PM, Iain Kennedy <ikennedy_msdn2@hotmail.com>wrote: > I think you need to plan quite smartly, the sale price at yseq runs until > Fathers Day and their tests *usually* take about 3-4 weeks to return so you > will probably squeeze in two rounds before the price goes back up. So one > idea would be to do the gambling on S7814 then if that fails go back up to > the big branches as Susan had outlined. But its really up to you. There has > been quite a lot of talk about the history of S7814 but a lot of it is > based on singleton surname results. > > The 'worst' place to be is S588 as that's the bushiest part of the tree to > refine. If you end up there and have to resolve it SNP by SNP you would > probably have been better off using Chromo2. > > Iain > > > > > > > Date: Sun, 27 Apr 2014 17:51:35 -0700 > > From: cecinit2007@gmail.com > > To: dna-r1b1c7@rootsweb.com > > Subject: Re: [R-M222] Advice on further testing > > > > On Sun, Apr 27, 2014 at 5:36 PM, Michael Helm <cecinit2007@gmail.com> > wrote: > > > > > > is S7814 an accessible SNP test, > > > > > I see it in yseq's catalog so a test there is available - good gamble? > > > > ------------------------------- > > To unsubscribe from the list, please send an email to > DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the > quotes in the subject and the body of the message > > > ------------------------------- > To unsubscribe from the list, please send an email to > DNA-R1B1C7-request@rootsweb.com with the word 'unsubscribe' without the > quotes in the subject and the body of the message >

I just checked my FTDNA homepage (after sending in a couple of questions to FTDNA) and they no longer have me listed as CTS 12173 but back to M222. They also removed the "i" from my long hand haplogroup designation. Brenden

Dear, Brett, Thank you! Indeed your S660 per Chromo2, you, and Iain; and thank you and Paul for the discussion on the Ward surname. Could I trouble you for your FTDNA kit ID and the project in which the haplotype rests so that I may pull it and add to the S660 portion of the SNP confirmed spread sheet? Thank you very much, Susan Hedeen On 4/28/2014 3:58 AM, Brett Ward wrote: > Hello all, my name is Brett Ward and I reside in Sydney, Australia. > > Mac a Bhaird (being Ward pre anglicised) as many of you will appreciate is an Irish occupational name (Bard, historian) and