This is a Message Board Post that is gatewayed to this mailing list. Surnames: Trujillo Wilson Wood Simmons Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/hY.2ADE/29.30.35.33.37.41.1 Message Board Post: Hi, I am researching my great grandfather,Theodore Trujillo, married to Cornelia Wilson. My grand mother Alta Grace Trujillo was from Trinidad, CO. She married Jerry Wood and settled in Fowler, CO. Below is a family history. Any infor would be appreciated. 1 Theodore Trujillo ---------------------------------------- Birth: Albuquerque, NM Spouse: Cornielia Wilson Children: Alta Grace (1908-1991) 1.1 Alta Grace Trujillo ---------------------------------------- Birth: 27 Apr 1908, Trinidad, Colorado Death: Nov 1991, Fowler, Colorado ss# 524-32-7800 Spouse: Jerry Wood Birth: 13 Feb 1892, Worth County, Grant City, MO Death: Jan 1971, Rocky Ford, Otero Co., Colorado Father: Edward Wood (1849-1924) Mother: Eliza Jane Simmons (1851-1940) Marr: 21 Dec 1927 Children: Edward Theodore (1934-) Jane (1929-1941) Jerry (1928-) Muriel (1932-) Corneilia (1936-) Mame (1937-) Franklin David (1941-) Janice Maude (1943-) William Daniel (1944-) Carol June (1946-) Mary Grace (1948-) Madaline Lee (1952-) 1.1.1 Edward Theodore Wood ---------------------------------------- Birth: 13 Feb 1934, Fowler, Colorado Spouse: Jeris Nanette Fleischacker Birth: 29 Jun 1936, Otero County, La Junta, Colorado Death: 17 Feb 1977, Otero County, La Junta, Colorado Father: Paul Ralph Fleischacker (1898-1985) Mother: Effie (Brooks) Belle Wright (1908-1985) Marr: 26 Aug 1955, Raton, NM Children: Paul Ivan (1960-) David Edward (1963-) Jeris Marie (1966-) 1.1.1.1 Paul Ivan Wood ---------------------------------------- Birth: 12 Jan 1960, Otero, County, La Junta, Colorado 5 lb, 8 3/4 oz 19" Long @ 7 weeks 9 lb, 8 oz 22" Long Oxford Ancestors mtDNA Sequence: ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGTCACCCCTCACCCATTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGGC Mutations at positions (129, 256, 270, 399) Oxford Ancestors Y-STR signature: DYS394/19 15 DYS388 12 DYS390 24 DYS391 11 DYS392 14 DYS393 13 DYS389i 10 DYS389ii 16 DYS425 12 DYS426 12 Relative Genetics/Ancestry.com paternal signature: DYS385a B (11) DYS385b G (16) DYS388 12 DYS389i 13 DYS389ii 29 DYS390 24 DYS391 11 DYS392 14 DYS393 13 DYS394 15 DYS426 12 DYS437 17 DYS438 12 DYS439 12 DYS460 10 DYS461 10 DYS462 11 GGAAT1B07 10 YCAIIa D (19) YCAIIb H (23) Y-GATA-A10 12 Y-GATA-A4 12 Y-GATA-C4 25 Y-GATA-H4 28 Relative Genetics/Ancestry.com Maternal signature: HVR2 73[G] 150[T] 263[G] HVR1 16129[A] 16256[T] 16270[T] 16399[G] Spouse: Teresa (Terri) Lynn Gelenian Birth: 10 Jun 1955, Racine County, Racine, Wisconsin Father: Ovagem (Augie) Gelenian (1928-1983) Mother: Rosemary Krikorian (1930-) Marr: 25 Jun 1988, Racine, Wisconsin 1.1.1.2 David Edward Wood ---------------------------------------- Birth: 20 Dec 1963, Otero County, La Junta CO 1.1.1.3 Jeris Marie Wood ---------------------------------------- Birth: 4 Apr 1966, Otero County, La Junta CO 4 lb, 4 1/4 oz 17" 1.1.2 Jane Wood ---------------------------------------- Birth: 29 Oct 1929 Death: 19 Feb 1941 1.1.3 Jr Jerry Wood ---------------------------------------- Birth: 10 Oct 1928 Spouse: Juanita Faye Clark 1.1.4 Muriel Wood ---------------------------------------- Birth: 16 Sep 1932 Spouse: Vincent Gilman Telfer 1.1.5 Corneilia Wood ---------------------------------------- Birth: 26 Apr 1936 Spouse: Eldon Reynolds 1.1.6 Mame Wood ---------------------------------------- Birth: 6 Sep 1937 Spouse: Gerald Phillips Children: Jane 1.1.6.1 Jane Phillips ---------------------------------------- 1.1.7 Franklin David Wood ---------------------------------------- Birth: 1 Jan 1941 Spouse: Judy Children: Kimberly Ann David Tracy 1.1.7.1 Kimberly Ann Wood ---------------------------------------- 1.1.7.2 David Wood ---------------------------------------- 1.1.7.3 Tracy Wood ---------------------------------------- 1.1.8 Janice Maude Wood ---------------------------------------- Birth: 19 Nov 1943 1.1.9 William Daniel Wood ---------------------------------------- Birth: 1 Aug 1944, Fowler, Colorado Spouse: Victoria Lee Goudy Birth: 27 Feb 1948, Fowler, Colorado Father: Vic Goudy Children: William Brandon (1970-) Joy Marie (1974-) 1.1.9.1 William Brandon Wood ---------------------------------------- Birth: 31 Oct 1970, Otero County, La Junta CO Spouse: Elizabeth Marie Wilke Birth: 7 Oct 1971 Children: Bryan Daniel (1995-) Jason Kyle (2001-) 1.1.9.1.1 Bryan Daniel Wood ---------------------------------------- Birth: 28 Oct 1995, Otero County, La Junta CO 1.1.9.1.2 Jason Kyle Wood ---------------------------------------- Birth: 15 Jan 2001, Otero County, La Junta CO 1.1.9.2 Joy Marie Wood ---------------------------------------- Birth: 21 Aug 1974, Otero County, La Junta CO Spouse: Stephen Donnell Grayson Birth: 23 Apr 1966 Children: Laiken Marie (1995-) Tristan Lee (1997-) 1.1.9.2.1 Laiken Marie Grayson ---------------------------------------- Birth: 13 Nov 1995 1.1.9.2.2 Tristan Lee Grayson ---------------------------------------- Birth: 10 Jun 1997 1.1.10 Carol June Wood ---------------------------------------- Birth: 27 Jun 1946 Spouse: James Clark Children: Ricky Jimmy 1.1.10.1 Ricky Clark ---------------------------------------- 1.1.10.2 Jimmy Clark ---------------------------------------- 1.1.11 Mary Grace Wood ---------------------------------------- Birth: 16 Apr 1948 1.1.12 Madaline Lee Wood ---------------------------------------- Birth: 3 Feb 1952 Index ? Judy spouse of 1.1.7 Clark James spouse of 1.1.10 Jimmy 1.1.10.2 Juanita Faye spouse of 1.1.3 Ricky 1.1.10.1 Fleischacker Jeris Nanette spouse of 1.1.1 Gelenian Teresa (Terri) Lynn spouse of 1.1.1.1 Goudy Victoria Lee spouse of 1.1.9 Grayson Laiken Marie 1.1.9.2.1 Stephen Donnell spouse of 1.1.9.2 Tristan Lee 1.1.9.2.2 Phillips Gerald spouse of 1.1.6 Jane 1.1.6.1 Reynolds Eldon spouse of 1.1.5 Telfer Vincent Gilman spouse of 1.1.4 Trujillo Alta Grace 1.1 Theodore 1 Wilke Elizabeth Marie spouse of 1.1.9.1 Wilson Cornielia spouse of 1 Wood Bryan Daniel 1.1.9.1.1 Carol June 1.1.10 Corneilia 1.1.5 David 1.1.7.2 David Edward 1.1.1.2 Edward Theodore 1.1.1 Franklin David 1.1.7 Jane 1.1.2 Janice Maude 1.1.8 Jason Kyle 1.1.9.1.2 Jeris Marie 1.1.1.3 Jerry spouse of 1.1 Jr Jerry 1.1.3 Joy Marie 1.1.9.2 Kimberly Ann 1.1.7.1 Madaline Lee 1.1.12 Mame 1.1.6 Mary Grace 1.1.11 Muriel 1.1.4 Paul Ivan 1.1.1.1 Tracy 1.1.7.3 William Brandon 1.1.9.1 William Daniel 1.1.9