This is a Message Board Post that is gatewayed to this mailing list. Surnames: Trujillo Wilson Wood Simmons Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/hY.2ADE/29.30.35.33.37.41.1 Message Board Post: Hi, I am researching my great grandfather,Theodore Trujillo, married to Cornelia Wilson. My grand mother Alta Grace Trujillo was from Trinidad, CO. She married Jerry Wood and settled in Fowler, CO. Below is a family history. Any infor would be appreciated. 1 Theodore Trujillo ---------------------------------------- Birth: Albuquerque, NM Spouse: Cornielia Wilson Children: Alta Grace (1908-1991) 1.1 Alta Grace Trujillo ---------------------------------------- Birth: 27 Apr 1908, Trinidad, Colorado Death: Nov 1991, Fowler, Colorado ss# 524-32-7800 Spouse: Jerry Wood Birth: 13 Feb 1892, Worth County, Grant City, MO Death: Jan 1971, Rocky Ford, Otero Co., Colorado Father: Edward Wood (1849-1924) Mother: Eliza Jane Simmons (1851-1940) Marr: 21 Dec 1927 Children: Edward Theodore (1934-) Jane (1929-1941) Jerry (1928-) Muriel (1932-) Corneilia (1936-) Mame (1937-) Franklin David (1941-) Janice Maude (1943-) William Daniel (1944-) Carol June (1946-) Mary Grace (1948-) Madaline Lee (1952-) 1.1.1 Edward Theodore Wood ---------------------------------------- Birth: 13 Feb 1934, Fowler, Colorado Spouse: Jeris Nanette Fleischacker Birth: 29 Jun 1936, Otero County, La Junta, Colorado Death: 17 Feb 1977, Otero County, La Junta, Colorado Father: Paul Ralph Fleischacker (1898-1985) Mother: Effie (Brooks) Belle Wright (1908-1985) Marr: 26 Aug 1955, Raton, NM Children: Paul Ivan (1960-) David Edward (1963-) Jeris Marie (1966-) 1.1.1.1 Paul Ivan Wood ---------------------------------------- Birth: 12 Jan 1960, Otero, County, La Junta, Colorado 5 lb, 8 3/4 oz 19" Long @ 7 weeks 9 lb, 8 oz 22" Long Oxford Ancestors mtDNA Sequence: ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGTCACCCCTCACCCATTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGGC Mutations at positions (129, 256, 270, 399) Oxford Ancestors Y-STR signature: DYS394/19 15 DYS388 12 DYS390 24 DYS391 11 DYS392 14 DYS393 13 DYS389i 10 DYS389ii 16 DYS425 12 DYS426 12 Relative Genetics/Ancestry.com paternal signature: DYS385a B (11) DYS385b G (16) DYS388 12 DYS389i 13 DYS389ii 29 DYS390 24 DYS391 11 DYS392 14 DYS393 13 DYS394 15 DYS426 12 DYS437 17 DYS438 12 DYS439 12 DYS460 10 DYS461 10 DYS462 11 GGAAT1B07 10 YCAIIa D (19) YCAIIb H (23) Y-GATA-A10 12 Y-GATA-A4 12 Y-GATA-C4 25 Y-GATA-H4 28 Relative Genetics/Ancestry.com Maternal signature: HVR2 73[G] 150[T] 263[G] HVR1 16129[A] 16256[T] 16270[T] 16399[G] Spouse: Teresa (Terri) Lynn Gelenian Birth: 10 Jun 1955, Racine County, Racine, Wisconsin Father: Ovagem (Augie) Gelenian (1928-1983) Mother: Rosemary Krikorian (1930-) Marr: 25 Jun 1988, Racine, Wisconsin 1.1.1.2 David Edward Wood ---------------------------------------- Birth: 20 Dec 1963, Otero County, La Junta CO 1.1.1.3 Jeris Marie Wood ---------------------------------------- Birth: 4 Apr 1966, Otero County, La Junta CO 4 lb, 4 1/4 oz 17" 1.1.2 Jane Wood ---------------------------------------- Birth: 29 Oct 1929 Death: 19 Feb 1941 1.1.3 Jr Jerry Wood ---------------------------------------- Birth: 10 Oct 1928 Spouse: Juanita Faye Clark 1.1.4 Muriel Wood ---------------------------------------- Birth: 16 Sep 1932 Spouse: Vincent Gilman Telfer 1.1.5 Corneilia Wood ---------------------------------------- Birth: 26 Apr 1936 Spouse: Eldon Reynolds 1.1.6 Mame Wood ---------------------------------------- Birth: 6 Sep 1937 Spouse: Gerald Phillips Children: Jane 1.1.6.1 Jane Phillips ---------------------------------------- 1.1.7 Franklin David Wood ---------------------------------------- Birth: 1 Jan 1941 Spouse: Judy Children: Kimberly Ann David Tracy 1.1.7.1 Kimberly Ann Wood ---------------------------------------- 1.1.7.2 David Wood ---------------------------------------- 1.1.7.3 Tracy Wood ---------------------------------------- 1.1.8 Janice Maude Wood ---------------------------------------- Birth: 19 Nov 1943 1.1.9 William Daniel Wood ---------------------------------------- Birth: 1 Aug 1944, Fowler, Colorado Spouse: Victoria Lee Goudy Birth: 27 Feb 1948, Fowler, Colorado Father: Vic Goudy Children: William Brandon (1970-) Joy Marie (1974-) 1.1.9.1 William Brandon Wood ---------------------------------------- Birth: 31 Oct 1970, Otero County, La Junta CO Spouse: Elizabeth Marie Wilke Birth: 7 Oct 1971 Children: Bryan Daniel (1995-) Jason Kyle (2001-) 1.1.9.1.1 Bryan Daniel Wood ---------------------------------------- Birth: 28 Oct 1995, Otero County, La Junta CO 1.1.9.1.2 Jason Kyle Wood ---------------------------------------- Birth: 15 Jan 2001, Otero County, La Junta CO 1.1.9.2 Joy Marie Wood ---------------------------------------- Birth: 21 Aug 1974, Otero County, La Junta CO Spouse: Stephen Donnell Grayson Birth: 23 Apr 1966 Children: Laiken Marie (1995-) Tristan Lee (1997-) 1.1.9.2.1 Laiken Marie Grayson ---------------------------------------- Birth: 13 Nov 1995 1.1.9.2.2 Tristan Lee Grayson ---------------------------------------- Birth: 10 Jun 1997 1.1.10 Carol June Wood ---------------------------------------- Birth: 27 Jun 1946 Spouse: James Clark Children: Ricky Jimmy 1.1.10.1 Ricky Clark ---------------------------------------- 1.1.10.2 Jimmy Clark ---------------------------------------- 1.1.11 Mary Grace Wood ---------------------------------------- Birth: 16 Apr 1948 1.1.12 Madaline Lee Wood ---------------------------------------- Birth: 3 Feb 1952 Index ? Judy spouse of 1.1.7 Clark James spouse of 1.1.10 Jimmy 1.1.10.2 Juanita Faye spouse of 1.1.3 Ricky 1.1.10.1 Fleischacker Jeris Nanette spouse of 1.1.1 Gelenian Teresa (Terri) Lynn spouse of 1.1.1.1 Goudy Victoria Lee spouse of 1.1.9 Grayson Laiken Marie 1.1.9.2.1 Stephen Donnell spouse of 1.1.9.2 Tristan Lee 1.1.9.2.2 Phillips Gerald spouse of 1.1.6 Jane 1.1.6.1 Reynolds Eldon spouse of 1.1.5 Telfer Vincent Gilman spouse of 1.1.4 Trujillo Alta Grace 1.1 Theodore 1 Wilke Elizabeth Marie spouse of 1.1.9.1 Wilson Cornielia spouse of 1 Wood Bryan Daniel 1.1.9.1.1 Carol June 1.1.10 Corneilia 1.1.5 David 1.1.7.2 David Edward 1.1.1.2 Edward Theodore 1.1.1 Franklin David 1.1.7 Jane 1.1.2 Janice Maude 1.1.8 Jason Kyle 1.1.9.1.2 Jeris Marie 1.1.1.3 Jerry spouse of 1.1 Jr Jerry 1.1.3 Joy Marie 1.1.9.2 Kimberly Ann 1.1.7.1 Madaline Lee 1.1.12 Mame 1.1.6 Mary Grace 1.1.11 Muriel 1.1.4 Paul Ivan 1.1.1.1 Tracy 1.1.7.3 William Brandon 1.1.9.1 William Daniel 1.1.9
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/hY.2ADE/154 Message Board Post: Hi I am looking for anyone who may have info on this couple Jose Cayetano Leyba married to Esquipula Rael they had 8 childern Jose Inocencio Leyba br.July 7,1871 Maria Dorotea Leyba br.June 3, 1873 she marries Jose Crispin Mehan Maria Rasario Leyba br.April 19,1875 she married Isidoro Torres Jose Turibio Leyba br.March 15,1877 Maria Apolonia Leyba br.Dec 28,1879 Manuela Rael-Leyba br.Nov 18,1884 she married Perfecto Espinosa Augustina Rael- Leyba br.June 16,1888 Jose Eduvigen Rael-Leyba br.Oct 15,1893 Three of these childern have there Mothers maiden name so I am not sure if there was a divorce or a death any info would be greatly appreciated Thanks to all and God Bless Cat
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/hY.2ADE/151.1 Message Board Post: Hi Mary I have a friend her name is Rosemary married to Aguilar I have jotted the names of thies people down and I will ask her if their any relation to her okay Do you have an email address if so send it to me my email address is flora03@msn.com
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/hY.2ADE/48.1.1.1 Message Board Post: Im not sure on the date when my grandfathers grandmother went to the orphanage in Kansas to bring them back to San Luis. Thier mother passed away in 1918 in Colorado thier father was still alive and passed away in Kansas City Missouri May 11 1947 Richards mothers maiden name was Colton. We know that Bell was known as Mrs Colton, Mrs Lee and Granny Lakino my mother doesn't remember her. She owned the hotel a lumber yard and coal yard in San Luis and passed it on to her grandsons at her death. They lost all of it during the depression. My Grandparents moved on to Denver about 1937. First and last I have of her is the 1920 census and am waiting on the 30's to come out. I have census back to 1860 on the Salazar side and have never come accross her prior to 1920. My grandfathers Father was Addison B Stone. He was born in San Diego Calif. I have not been able to locate him through any census though. His father was Addison Stone and mother was Mary Robinson and was born Oct 16 1886! . Are you related to the Lee side of this family?
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/hY.2ADE/48.1.1 Message Board Post: Robert, I really do not have much information about Bell. But we might be able to put some things together and find more information. C.H. Lee's family came out of KS to CO in 1884. On the census information Bell appears to be his wife's first name. Do you have a surname? Family reports of visits say she was a very nice person, and they always enjoyed having her. Charles had a brother in the Durango area. Do you know what year is was that she went back to KS and got her grandchildren? Karen
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/hY.2ADE/48.1 Message Board Post: Karen I am the grandson to Richard Stone, grandson to Bell. I have been looking for information on Bell for some time. I know that Bell went to Kansas City and brought Richard and his brother Jack back to San Luis where she raised them. Richard married my grandmother Agueda Salazar in San Luis and they had a set of twins that passed away in infancy they also had three daughters and a son my mother was the youngest girl. Richard passed away in 1966 in Arlington Texas and Agueda in 1972 thier oldest daughter Betty passed in 1973 my mother lives in Louisiana and her brother and sister both live in Texas. Ive been trying to find the link to Richards mother I know she passed away in the flue epidimic of 1918 in La Veta Colo along with her daughter. Miss Bell would be my gggrandmother
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/hY.2ADE/64.63.1 Message Board Post: hi i was wondering if you could give me any more info on the vialpando/duran that moved to colo my husband's grandmother was married to a vialpando not sure what his name is matilda is his grandmother they lived in manassa colo thank you ida
This is a Message Board Post that is gatewayed to this mailing list. Surnames: Stevens/Eldredge Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/hY.2ADE/153 Message Board Post: My great great grandmother Belinda Eldredge Stevens died 19 Sep 1898 in Costilla Co., CO. She and her husband Carlos Stevens were living there at the time of her death. Does anyone know where she lived and was buried in Costilla Co., CO? Any information about Belinda or Carlos Stevens will be greatly appreciated and I will be glad to exchange any information I have. In genealogy friendship. Becky
This is a Message Board Post that is gatewayed to this mailing list. Classification: Military Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/hY.2ADE/152 Message Board Post: The Colorado Springs Daily Gazette (El Paso County, CO) 4 May 1878; page 1 All the disposable cavalry recruits have been ordered forward to Fort Garland, for assignment to the Ninth Cavalry.
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/hY.2ADE/39.39 Message Board Post: Juan Andres Chaves and Maria Candelaria (Sanchez) Chaves were my great grandparents. I do have futher information on their line if you have not already found their lines. My grandmother was Maria Placida Chaves who was a daughter to Juan and Candelaria.
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/hY.2ADE/64.64.1.1.1.1.1 Message Board Post: Juan Eluterio Vialpando and Maria de Jesucita Duran 1880 Rio Arriba, New Mexico Census Listing
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/hY.2ADE/64.64.1.1.1.1 Message Board Post: the parents of Jose Acasio Vialpando: Maria de Jesucita Duran and Juan Eluterio Vialpando
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/hY.2ADE/64.64.1.1.1 Message Board Post: I've been trying to post a reply but I am having a terrible time getting this website to upload anything from my computer....huh....so I've e-mailed you instead Joseph
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/hY.2ADE/64.64.1.1 Message Board Post: Sounds like you have confused Edward Mestaz with Jose Vialpando (Villalpando) - who was his father. Jose (who was a Judge) lived Tierra Amarilla, New Mexico. Jesusita parents of Edward aka. Edward Mestaz, Edward who had 6 siblings Tia-Dorotea (lived in Oakland, ca),Tia-Francisca (who lived in San Leandro), Solomon, Tomas, Tia-Magge (husband Maclovio); also Edward married Clementina Cordero whom had 14 children. Most of this information came from the back of a photograph that is in the possession of my parents. My father recalls my uncles Johnny and Eddie driving to Tierra Amarilla to visit.
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/hY.2ADE/151 Message Board Post: Can anyone give me information on Sais Aguilar, Cornelio Aguilar, Clotilde Aguilar (married Medina) Gregorita Aguilar
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/hY.2ADE/150 Message Board Post: Am looking for anyone who knows of the Andrade family in Yuma, Az. Looking for info on Grandfather Angel Andrade. His father's name Jose Andrade.
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/hY.2ADE/149 Message Board Post: How do you know this Juan is from Costilla?
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/rw/hY.2ADE/148 Message Board Post: Does anyone have any information from the San Luis Valley on my family? Thank you Mary
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/hY.2ADE/147 Message Board Post: GOLDIE MARRIED THOMAS BREEN IN SOUTH FORT CO. LOOKING FOR INFORMATION ON GOLDIE RINZ AND THOMAS BREEN
This is a Message Board Post that is gatewayed to this mailing list. Classification: Query Message Board URL: http://boards.ancestry.com/mbexec/msg/an/hY.2ADE/20.1 Message Board Post: Did you find out any thing on thomas and goldie,I have some but will have to find it if you still need it Ellen